Transcript Name :
Sappa_CBS223.65SPRG_00030
Orientation:
(+)
Number of Exons:
1
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.660.74517
InsideOutsideTMhelix
57-107
1-33
34-56
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        397 bases(100 bases per row)
CGACAGTCGTTTGCAGGTCACGACGCGCCAGTTTGGATTTGGCGGCGATGGCGGCAACGTGGTGTCTGATGCTGGTGGTGGCGGTCGCCGCTGCCGACAA
CCGGTACGAGCCAGGCACGACGCCGTCGATGCAGGCCGTCGTCCTTGGCCTGCCTGTCTGGGCGTGGATCCTCATCGGCTGCGCGCTCTTGGCTGGCGCC
GGCTATGGCCTTTGTCGCCACCTCGAAAAGAAGATGGCAGCCGACGATGCAGCGCTTCCGGTCGTCTACGTTGAAGCCAAGTCGACTAAGGCCTCGCCGG
CCATCGTGCTTGCCGACGCCGCATCCATCGCGCTCGCCAAGCCTGCGCCGCCGCCCCACGTCGTCGTCTAAGCACCCAACACGACTCTATTTATGCA