Transcript Name :
Sappa_CBS223.65SPRG_00039
Orientation:
(+)
Number of Exons:
1
Description :
PREDICTED: vignain-like
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8520.89218
InsideOutsideTMhelix
1-585
NN-scoreoddsWeighted Score
0.7092.4410.005
*** None ***
TypeScore
vacuolar222
GO
*** None ***
*** None ***
*** None ***
Sequence
        1758 bases(100 bases per row)
ATGGCCGCGTTCGCTCTTGGTGCACTTGCTCTCGCTGCCGCCGTGTCTGCCGCACCCATCGACGACCGCGATGCGCTTCGAAAGGAGCTGTCCGCGTGGA
AGGCCAGCGACGCCGGTGTCTACGCAGCTGCCAACGGTCTTCTTCGCGAGCACCTTGACGGGGCGAGCGAGGACGCGGAGCTCGCCGTCTTTGCGGCGAG
CAAGGCCGCGGCGGCTGCGCTCCAGAAGGCGCACCCGCTCGCCGAGTTCTCCGTCGACACGCCGTTTGCTTTGATGACGAGCGACGAGTTTGCGTCGTGG
GTCACAGCAGCACGCCCGGCGCGCAACGCATCAGCGTTGCCCGCGTCGTCGGAGGGCATCTCGGTTGCGACGAACACGGTCGACTGGAAGAAATCGGGCT
GCGTCGCGCCGGTCAAGGACCAAGGCGGCTGCGGCTCGTGCTACGCCTTCTTGTCCGTCGGCGCAACGGAGAGCGCGTACTGCCTCGCCCACCACCAACG
GCGCACGCTCTTCTCCGAGCAGCAGACAGTGAGCTGCGGCCCAGGCTTGGGTTGCCGAGGCGGGTACCTCGACGACTCGCTCAAGTGGATCGCTTCCAAC
GGCCTCTGCACGAGCGATTCGTACCCATACACAAACGGGCAGAGCGCGACGGCGCATCCGTGCCAGTCGACGTGCCAGAAGCTCCCGATGCCGTTCTCCA
ACATTGCGGTTGTCGCTGGCGAAGACACGCTCGAGAAGGCGCTCAACACGCAGCCCGTGGCCGTCGAGGTGGCCACGGGTGGTGACACGTGGCGGCTCTA
CAAGGGCGGCATCATCACCGGTGGCTGCTCGGGACCGCTCACCCACGGCGTGCTTGCGGTCGGGTACGGTGCCGCCGGGTCGCCGTACTACAACTTGAAG
AACTCGTGGGGGCCCAACTGGGGCGAAGGCGGCTACGTGCGTCTCCAGCGTGGCGTCGGGGGTCCCGGCATGTGCGGCGTCGCTTCGTTCATGGCTTACC
CCGTGCTGCGCAAGCCGCAGTTCTACCTCGTCACCTCGCACGGCCACCTCATCACTGAGTTTTACTCGGACCTCTACGCGTCGTCGTCGACCAAGTCGGG
CGCGATGAACGAAGAGTGGAGCTACGACTTCACGACGCGCCAGATCATCGTGCACTCCAACTACGAGTGCCTCGACGCGTACAACGACGGCGGCACGTAC
CGTGTCCACACGTACAAGTGCGACGCGAGTAACCCGAACCAGCGCTGGAGCATGGACAACTACCGCGTCCAGCACCTCCACTTTCCCAACCTCTGCCTCG
ACGTCGACCCGAACCAGAACCACAAAGTCCAAGTCTGGTCCTGCGCCGAGAACGCGCCGAACCAGCGCATCACGGGTGTGTGGGACGAGAAGGTGACGCT
GCGCAGCTTCAACCAGCTCACGATGGGTGTGGACGGCGACAACGTCCAGTTCAACGGCGGCGTCGAGTGGGGCGTGAGCGTGAGCGACGACACGTGGCGG
GCGCGGACGGGCGATTGGACCAAGTGCCTCGACGCCTACGACGCGCGCAACGGGGGTGCTGTGCACTTGTATCCGTGCGACGGCAGCAACCTCAACCAAA
AGTGGCGCTACGACCCGGCGACCAAGCAGCTCAAGCACCTCACGCACGCTGGTTTCTGCCTCGACATGGGCTCGGAGGCCGGTACCCGCGCACACCTCTA
CTGGTGCAACACGGCGATTGTGCTCCAGCTCTTTGACCGCGCCACGTCACTTCTCTAG