Transcript Name :
Sappa_CBS223.65SPRG_00056
Orientation:
(+)
Number of Exons:
1
Description :
beta-amylase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5760.76419
InsideOutsideTMhelix
1-450
*** None ***
*** None ***
*** None ***
GO
*** None ***
KO ID
K01177
*** None ***
Sequence
        1459 bases(100 bases per row)
TTTCCCAATTTGCCAGTTTCCGAGCAATAGCAGCATGGTGCGTCTGCTTCCTTCGCTCGTCGCCGCCACGCTCGCGCTTGTCGCTGCCGAGGTGCCTGTC
AACGTCATGCTCCCGCTCGACACGGTCGTTCTGGACTCGAAGGCGTGCAGCAGCACCCGGCTCAAGAATGCGACGGCGCTGAGCCTCCAATTTGAAAAGC
TCAAGGCGAGCGGCGCCACCGGTGTCATGGCCGACTGCTGGTGGGGCCTCGTCGAAGGCGCGGGCCCGCGCCAGTACGACTTTGCCGCGTACGCGGACCT
CGCGCGGCTCGCCAAGGCGTCCAACCTCACGATTCAGATGGTCATGTCCTTCCACCAGTGCGGCGGCAACGTCGGCGACGAGTGCGACATCCCGATCCCG
CGCCACTGGTTCACCAAGGACGACGTGTGGTACACCACGCAGGCCGGCTTAACCACGAAGGAGTACATCTCGCTCTGGGCCGACGCGACGCCGCTCGACA
AGTTTGGCCGCACGCCGCTGCAGATGTACAGCGAGTTCCTCGCGGCCTTCAAGACGCACGTCGTCGACGCGTATCCGGGTGTCGTTTCCGAGGTCCAGAT
CGGCGGCGGCCCCGCGGGCGAGCTCCGGTACCCGTCGTACCAGCTCCAGGAGAACCGGTGGAGCTACTGCGGCGTCGGCGAGTTTACGAGCTACGACTCG
TACGCCAACGCGAGCATCGTTGCGCATGCCGCGTCGACGGGCCACGCGCTCTGGGCCACGCGCCCGGGCCCGAGCAACGCCGGCACTTTCAACTGCCTTC
CGAGCGAGAACGGTCCGTGCCCGTTCTTTGCGAACGGCGCCGACAACTTTGCGAGTCCGTACGGCCAGTTTTTCCTCGACTGGTACAGCGGGTCGCTGCT
GCAGCACGGCCGCGACCTCTCGAAGCTCGGCCGCGACGTCTTCCCCGCGCCGTTTGAGCTCTCGGTCAAGGTCTCGGGCATCCACTGGTGGTACGACTCG
CCGCACCACGGCGCCGAGCTCACGGCCGGGTACCAAAACACCAACAACAAGAACGCGTACTACGACATTGCATCGATGCTCAAGGAGCACGACGTGCGCT
TCTGCTTTACGTGCATGGAGATGAACGACAACTACGACGACAACGACAAGTGCCGGTCGCGCCCCAGCAAGCTCGTGGGCCAGGCCCGCGACGCCATCAA
CGCGCTCGGCCTGAGCTTGAAGCACAGCTTTGCGGGCGAGAACGCGCTCCCGATTGGCGGCAACGACCAAATTTCGGCGATCGCGGGCCATATCGCCGGC
GCCGCGTCGTTTACGTTTTTGCGGCTCACCGATTCGTTTGACTTTGACTACTTGGGCCGCCTCGTGCAGCGCTTGAAGACGGTCTAAAACCATTTTGTAT
CCGATCCTGTATAAGAATAGTGTTGTTGTATACAAGTAGTACATCCTGTTTGACGGACC