Transcript Name :
Sappa_CBS223.65SPRG_00026
Orientation:
(+)
Number of Exons:
1
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7450.86420
InsideOutsideTMhelix
1-94
198-234
118-174
95-117
175-197
NN-scoreoddsWeighted Score
0.6271.6850.003
*** None ***
TypeScore
endoplasmic reticulum556
GO
*** None ***
*** None ***
*** None ***
Sequence
        917 bases(100 bases per row)
TCTGCATCTTCCGTCATCTCGGCGTATCCAGCATGCTCATGCGCCAAGTGCTACTGACGCTCTGCGCCCTGGTCCTCGTGGCCGTCGCGCAGACGACGCC
GACGACGACCAACCCCTTCCTCCCGGCGGAAAGCGCCTGCCAGCGCTGCGCCAACTCGGGCACGTGCGACCAAGCGTACCGCGGCAACGCGGGCAAGTAC
TGCGGCAACTGGCTCGCGCCCCCGAACCTCGCGCGGGCCGTGTGCTGCTGCCCGACCAAGAGCGTCTGCGCCATCTCGGCGAACCTCATGCGCTGCGAGT
GCCGCGAGGAAAAGTCGATTCCGTACTGGGTCTGGATCCTCGTCGCCATCGGCGTCATCCTCATCGGCGTCGGTATCTACTTTTGCTGCTGCCGCCCCAC
GCCCGCTCCGGAGGCCGTCTACGTGCAGCAAGCCGCGCCCATGTACGTCGAGCAGCCCATGGGAACGTGCGGCCAGCCCGTGTACGTTCAAGGTCAGCCC
ATGATGGTCAACGGCGGCTACGGCTACGGCGGCTACGGTGGTGGCTACGGCGACGGCGGTCTCGCAGCTGGTGTCGCGGTCGGCGCCACGGCGGGTCTCG
TCGGCGGCCTTGCGCTCGGCGCTGCCATGGACGCGGGGCATGGCTATGGCTACGGTGGTGGCTATGGCGGCGGCTATGGCGGCGGCTACGCGGGCGAAGG
CGGTGGCGGCGGTGCCACGTTCGGCGGCGACTTCTAAGTGCGAGCTGTCGAATCTATCTATTGTATTATCATTTGGAGTGAATGCTTGGTACGTGTCGCC
CGCACGTCGGATGCTCCCACTGGACATAGCTCAAGAAACGCCTCGATGAGAGAGAATAGCAGTCGACACAGAGATGACATTATTGTCAGCGATTAATTCC
AGTTGCTGCTTGGCGGT