Transcript Name :
Sappa_CBS223.65SPRG_00003
Orientation:
(-)
Number of Exons:
10
Description :
Hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.6750.79329
InsideOutsideTMhelix
1-11
1012-1409
1470-1480
35-988
1433-1446
1504-1568
12-34
989-1011
1410-1432
1447-1469
1481-1503
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
638
Sequence
        5300 bases(100 bases per row)
ACAACGCGAGAAGATTGCTTCCGCATGCGACGCTGCTGCCCGTGGAGTCGTCTTGCCCTCCTTCTCGTCCTCTTCGCTGCGTGGGCCCCGCTCGAGCCGG
CCGCGGCCACGATCATCGTCGGGCCGAGCACGTCCCCGGACGCTCTGCGCGCGCTCTTCCACGTACGCGCCATGCATGCCACGATGGCCTCACAAGCGTG
CTGTCTAGTGCGCCAGCCGACAATGGATCGGCCGCTACAACGAACTGTACCAAGAGTGCGTCTTTGCCAACACGTCCGAGAGCTTGCTCATCGTCAACAC
CACCATCGACGCCACGGCCCTCTTTGTGCAGGACCATGGCCCGTTTGCCGTGCACATTGAGCTCGGGGTCCAGCTCAATAGGACGTCCGGCACGCTGCGT
CTCGAGAACGCAACGCTTTTCGCGTCGGCCGTCTTTGTCGACGCCGCCAACGTCTCGCTGGACGCAGCGTCGGCCATCAACACGACGGCCAACGGCCTCC
GCTTCGGACCTGGCTACAGCTCGTACGTGCCGATGGGCAGTGCGTACGGCGGTCTCGGCGGCTACACGCTCTCCCACGCTTCGTTCGCGGTCCCCGGCTC
GTGCGACGACATTGACCGCGACGGCGCGTACACCAAGCCGATCGGCGACCTCTTTGGCCACGTGATGGACTTTCGCGGCTACGGCAGCGGCGGCAGCGAG
GCCGACAGCACGCGCGGCGGCGGCCGCATCTCGCTCAACGTATCGGCGACGCTGCAGCTCGACGGCCGCCTCTTGGCCGACGGCGGGTTTGATGCGACCT
TCAGCACCAGCTCGGGCGCCGGTGCGCTGCTTCTTTTTCTAGAGTCGATGCCTGGCTGATGTTGCCACTTGTGTAGGCGGCACTGTCGTCGTCCAGGCGT
CTGCCGTGCGTGGATCGGGTGTGATTCAAGCGGTCGGCGGCCAGGCCACGGCGCCCGATAGCAGCGGGCGCGGCGGCGGCGGCGGTGGCGGCGGCGGGCG
GGTGTTCCTACATGTTGCAACCGCGCCAACGATCGCCGTCCGCGCATTTGGCGGGCGCCATGCATCGCCTGTGGACGACGTTTTCTGGTGCCAAGAGGGC
GGTGCCGGCACGATCCTTGTCGCGACGCAGCGCGACAAGACGACGGTCGACGGCCAGCTCGTCATCAAAGGCCGCGACGGGCCGCCGAAACCTCCACGCC
GGCTGGTTGTGGGCACGCCACTCTTTTACTGGACGAGCCGCCGCGAGCACATGCTGCCGCCGTGGCTCAACTCTGTTGTCGTGGCCGGCCAAAGTCTCTT
GATTGCCAGCACCGTGCTTCTCGAGGTACGAACGACTCGCTACTGCAGCAAGGCGTCATGGATCGTATCTGCTAGCGTGGCGCGGCCAACACCTCGATCC
TGGTACTCTCCGTCGTCTGCTGCGGTAATTCATTATCCATCCCTGTAGCTCGAGGCAAGCGCTGCGTGGGCCAACGCCGCCGACAACAGCACACTGCACG
GCAGTGCGACCAACGTGACGCTCCACGTACGATGCGGCGCTGTCCGTCGCCTCTCTACATGGCGCGTAGGGCTATGTGGGGCCGCTGCCAGTACGAGCGT
TCGAGCGAGGCCGCGTCGTGCTCACCGCCGGCGACCTCATCCTCGTCGGCGCGATCGTTGACGCCGCGCAATTGGAGCTGCGCGCCGATGTCGGCAGCGT
CTCCACCGACGACGACTGCACCTTGCGCTTCGAAGATAGCGTGTTGATGGCGTCGGCGGTTGATATCGACGTCCGTGGCGCCGTCGAGCTGCCGCCGTCG
CGTCATCATCGAGGGTGGCGTCGAGCACCGAGCATCGTTCTCGAGAGCCAGCGCCACACGCGTGTGGCGTGGCAGCCGAGTCTCTCGCTGGCGTCCGTCG
ACGTGGCGGTGCGTGCTCCCGCTCTCGCTGTATGTCTCACAAAGCAAGCAGGTGCGCGCGGTCAACCAATCGGTGCTGACGATTCACGGGCCGCTGCGCC
GACTCCGCGTCGACGCTGGCACCATTGAGTGCACTGGCGGTGTCAATGGCTCGTCCACGGTGTTTCCCCACGAGAGCCGGGACATTTGCCGGCCGTGGCC
CGTCGATGACGACTGCGCGTCGGGCGACTACCAGCTGGCACTGGTCGCCACATCGTCGCTTGCCGTGGCCGACGTCCATGCGAGCTCGGTGCTCCTTTGC
GCACCAGATGTTCGCGTCGGAGGCTCGGGTGTCGGCGCCGACGGCCTCGGCTGCAAGGAAGACGGCCCCGGTATCTCGACCGAACTGGATGGCGCCAGTG
GCGGCGCTGGACACGGTGGTCGGGGCGGCAACGTCGAGCCCGGCGATCGAGGTGGTGGCGCGACCTGCGACGCGTCGTGGCCTGGCAGCGGCGCGGCCGG
CGACTCGACCGGCGGCCTTGGGGGCGGTCTCGTGCTGCTCCGCGCGACGACTCTGGCTCTCGATGCCGGGCTGAGCGTCCGCGGCGGCAACGGCACGGCG
GGTGGCGGCGGCGGCGCCGGTGGTAGCTTGCTCCTCTTCCTCAAGGAGCTGCAGGGCAAAGGCTCTCTCGACGTCAGTGGCGGTGCGGGATCGTCGACGT
CGGAGCGTCACGGCGGCGGCGGCGGCGGCGGGGTCGTGCGAATTGCGTACGCGCCCGACGGCAGCGGCCAAAAGTACCTCGGAACCGTCGACGTCGCCGG
CGGCTCGAGCGCGGGTCAAACCGGTTACGATGGGCTCATGGCCGGTCTCAACTGCGTCGCGGGCTGCGGAGGCGTCTTTTGCGCGCCGTGCGCCGCGGGC
CAAGCGAGTGCTGTCGCCAACGGAACGTGCGAGCCCTGCGCAAGGGGTACGTTTAGTGCCCAAACGGGCTCGACCGCCTGCACAAACTGCGCGCCCGGGT
CGTTCAACCCTACGAACGGCTCCACCGCGTGCTTTCTGTGCGCGAAAGGCCAGTTTGCCGCCGACGCCGCGGCCACCGCCTGTACCGCGTGTCCACCCGG
CAGCATGAGCCCAGAGAAAGGGGCCGTGCACTGCACGTTGTGCCCGATCGGCAGCACAGCGTCAAAAGCTGGCAGCGCGACTTGCGACCTCTGCGACGTC
GGCCACACGACCCGAGCGGTTGGCAGCCTCGCTTGCGTGCGATGCGACACCAAGCCGTACCACGCAACGTACAACCAGAACGGGACGTGTCACTACATGT
GCGAGAAGGGCCGCGTCGGGCTCAAGTGTCTCACGCCGTTCGAGCAGCTCGTCGCGCCGATTGGCGGGCCCCTCGGCTTCGTACTCCTCTGCCTCGGCTC
GATCGGCCTCATTTTCGCGGGCTACGGCATGCTCTCGTACCGCGGCCCGCCCGCCTCGCGCCGTCTCAAGCAGTACCAAGCCCAATTGCTGCGCCAGAAC
GTCCTCAAGCACGCCCAAGTGCGCGACGACGGACGCCGCTGCCCGCACTTGAGCGACCACCAGCTCCCGTTCCACGTGGCGCGCATCTACTTTGAGGGCC
ACAACGACGCCGCTGATCCGTGGCACCTCTCGACCGCTCTCTTTGTGGACAGCACCCTGCGGAAAGCGCTCTACGAAGGCTCGTTCGCGGCCTTCGCCGC
CAAGTGCAACCACCTCTTGCGCTCGCAGTCGTACGCGATGCCGCTGCTGGATGCGATTTGTATGCTCACACTGCCGATCCTCGGGCACGGATTGCGGCGC
CGGTACCGCCAAGCGGCCGTGCGTGCGGTCGCCACGTACGTGGACGAGTACGGCGCGGGCTTCTTTCGCGACCTCGACGTCCGACGCCACGGCGCGTCGC
TGCTGCTCGGGTTTAGCGACGACCTGCGCCTCGGGTACCTCGATCTGCTCCTCTCGCCCGACGCGCAGCGGCATTTGGAGCTCTCGCCGACCCCGGCGCT
CGTGTTTGCGCTGGCGGGCGCCGGCACGTTCTTGCACCCGTGGCACCTCGACACGAACGACGCGCTCCTGCGCAGCGTCCCGTCGCGGCTCCAGGTGCTG
CGGGACAGCGGCTGGCTCGAATTCGTCGCGGCCCTCAACCTGGCCCTCCGGATTGTCTTGCGTCGGGAATGCCCGGCGTCGCTGACGCCCGTGCAAGTGC
TTCTCGCGCGCTTCAACGACCAAGACGACCTCAACGGCTACACGGTAAAACCTCTCGCACGTAGACGCTGGACGGCAGACTCGATCCTAGGTGGCCCTCG
GTGTCTTCAACCTGCGCGAGAGTGGCAAGCCATCGACGTACCTCGAGTCCATTCGCGACGTGGACTCGGGTCTTGGCCCACGCGACAAGATCGTGCTCGT
CTTGCGCCCACCGAGAGACTCCATGTCGGTGGTGACGGCACCTGCGTCACCACCCGCTACCGATGCGAGCATGTCGATGTCGTCGATCCGGTATGCAGCG
CTGTATGCGCCAGAGCCCAAGGCCATCGCGCTCGAAGAAGCCGTGGGACTCGTTGATGACGCGCCGCCGATGACGCAACCCACGTGGCGGCAGCAGCTGC
GGCGGGCCCTGGACGCGATTGCGCCGACGCACGTGGCGGTATCGCCCGGTTTGCTGCGCTACGCGTGGGGCCGTCCCGTCTCGTTCCTTGCGCTTCTCGT
GGCCGATTTCCTCTTGTGGTTCTGGCTCGCGCTGCAGTTTTTCTGCATTCAAGTCGGCGACCCGACGGTGCACGAAGCCGGCTGCTCCCACGTACGCCTT
GTATTTGCCATGACGACGAGGCTTGGAACGCGCAGACTATGTAGGCAGCGCTCGTGCTCGTACTCAGCGTCATGCCCCTCGCGGTGCTTGGCGCGCCGCT
GCTGGGCCTCGCGTTCGTCTTTGGGAAGCGGTCGTCGGTGGGGCGCCTCGTACGTTCTCTGCAATGTCTCAAACGGCTAAGATCTCGTATGTGTCTAGTT
TGTGCTCTGGACGGCCACGTGCTACTGGAACGCGGCCACTGCGTTTGGCTGCGGCGTCTACTACTCGGCGTACGTCGGCGACTCGGTCCTCGGCCTCTCG
CTCGTCGCCGCGTGCGTCAAGTGGCTCGAAGCGCGCTGGGCGCTGCGGCTCCTCGCGCAGTTTGAGGGCGACCGCAGCAGCCGCGGCTGGGCCGGCCTCT
TTACGACGCGCGACTACTACGACTGCGCGGACCGGCCTCTTGGGCGCTGGCTGGCCACGTAGGCGATGCACCTCGTCGCCCGTGGCTTGGCTTCGAGCAC
GAAGCTCCGATCGGGAAGATCCAGCGACATGAGGTGTGTAGCAATCACTAGCTGTGCAGCTAATTCGTACTTGAATGCCGAAATTAGACGCCCTGTTGAG