Transcript Name :
Phypa_INRA-310PPTG_20019
Orientation:
(-)
Number of Exons:
1
Description :
secreted RxLR effector peptide
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.760.83520
InsideOutsideTMhelix
1-107
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        505 bases(100 bases per row)
CAAGGCTCTTCCTTCCATTGGACACCCTCTCTAGACATCCATGTGCAGTCTATTCTACATCGCTCTTGTCTTTGCTGCTTGGGCTCGCAGCAGCGCCGCC
ACAGCGTTCCCTCATCCCAACGAGTCTGGGCTCTTGTCGCAGATATCTCCTGACTCTGCGGCCAAGGCCAAGAGATCCCTTCGAGTCGCTGGCCAAGAAG
TTGTCCAGAGCACGGGGAACGGGTACGGTGGGATTTTCAAGTCAGCAGGCACGAGTATCAACAAAGTCATCCCAAGGCCGGACTCTCCGAAAATGAAAGA
ACTGCTTAAGAAGGCCAACTTGGCCCTGGCGATCAAAAATGCTTTGAAAAAAAGTAACAAGTAAAAGGTGGTTCCCTCAAGTCCTCGCGTCGTATAGAAG
CCCGGGAAAGTAGCTTCAGCTGCAAAGAGAGAGTCTGCAGCTTCCCTCTGGCAGTGCGAAAAAGTCATGACGAGGTCATTCTGGACAACTTTCTAGTAAA
CAAAT