Transcript Name :
Phypa_INRA-310PPTG_19763
Orientation:
(+)
Number of Exons:
3
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-198
NN-scoreoddsWeighted Score
0.8815.150.01
*** None ***
TypeScore
nuclear783
GO
*** None ***
*** None ***
Cluster Id
4274
Sequence
        934 bases(100 bases per row)
ATTTTCATACAAACTTTGCCCGCGCTGATGGAGCAACCTGCACCGACCAAGAATGGGCAGCACATGCTGTCGCACTTGCTGGCCATCGCGTATCATGTGC
TGGAGGAGACTAAGTACATGAACCTGAGGCCTCCGCTTCGTCCTAGCTCCAAGCTGTTCGCACTCGACGCGCCTGCTCCGGGCTCACCCCCACGCTCCCC
CACTGAGGCCGATACACCGCAAGATGAGACGCATCCGGACGTCAATGGGCTGGCCGCGGGCTTCGCAGGTGCCGCGCACACGCAAACAGGCAATCAGGGT
CACCCCATAGTGCTCCCGTACTCGCCCGAGGAGATCCAGGACACGTACACAAAAATTGCGGCGCTCAAAGCTCAGTACATCAAGATCAGCGCCGAGTTGC
TGGAAGCTGTCAAGGAGGTGGAGGCCAAGAAGACGCCGCCGCAGGACGATAAGGTGACAGAAACAGCATAACGCTTGGCGGTTTTCAGACTGACAATTGG
TGATGTTGCTGCAGGACACGATGGCGAAGCTGGTGGCGAGGAGAAATCAGCTGCGCAAGGTGAGGCGATCGCAGTAATTTACTTGAGGTGGTGCCGTGCA
ACTGGTAATATATTGTATGTTGCAGGAGGTGTACGAGAGGAATCTGGTGATGAAAGGGCTTATCGACTGGCTGCGTAATCTGCAGCACTCGATCCGGCTC
ATGAAGGGAGGCACCGCGAACCCGCCCAATATCGTCATGGAGAGCGTCTAGATTGATCAGACTATAGTGACAGTCTTTTTTCTTCAATTTAATCAAAACG
CTATTTATCAGCGTTATTTGTCAGCCATATACTGCAGGGTGTCGTCTGCCAGTGATTTCGAGGAAGGTGAGTTCTCGCTGAAGCGATTGTTGCGAATCAC
TGAGCTCTTTGGCGTAGGCTACCAGCTGTGTGAC