Transcript Name :
Phypa_INRA-310PPTG_18874
Orientation:
(+)
Number of Exons:
1
Description :
ubiquitin-specific protease
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain11.556PS50222
Peptidase C19, ubiquitin-specific peptidase, DUSP domain16.536PS51283
Ubiquitin carboxyl-terminal hydrolases family 231.629PS50235
HmmSmart predictionP-Valprediction_id
Peptidase C19, ubiquitin-specific peptidase, DUSP domain1.1SM00695
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1510
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
obsolete ubiquitin thiolesterase activityGO:0004221IEA
ubiquitin-dependent protein catabolic processGO:0006511IEA
*** None ***
*** None ***
Sequence
        4708 bases(100 bases per row)
CGAAAAAAGAAGAAAGAATTCACCACAGTGGCCCTGTATACGGCACGCCAAAGCGAACTTCGAATCACCGTCCAAATCTGAAAACCCCCACAGCACATTA
GAGACAGCCTCCTCATGCGCTCCTCGTCCTCTCCACGCGGCTCGCTGCGTCGCTTCTTCTCGCGTCGGCGTCGCCGCGTACCTCGCGGTGCATCGGGCCG
TACGACTCCCGTGACTGGAGCCGCCGCACAACGATCGCTGGCTGCACGGACGCGGCTGCTGGACTCATGGAGTCTACCAGAGCTCTTTGCGCTGCGAGAG
CTCGTACACATCGCCGTGAACAAGACCTTTATTGCGCCAGATGTGCAGCTCGATCCTCCAGCTCTTCAACGCGCCGCTCGTGGCGACGAACCGATGCGTG
CAGGTACCAGCAGCTCCGCCAGCTCCAGCACGACAGCTACCTCCAGTATCGAAGACCTCAAACGCCAGCAGCAGCTGCAGACACACGTGGACTCGGCTCT
GGTGCGCAGCAAGCGCTTCTACTTCAGTCGACGCGCCGACACGAGGCTGCGGCTCAGTACGAGGAGACAGTTCGTGCGGCTCTTCCCGCTGCTGAGCCGC
ACGTCCAGAACAGCGCAGCGCGCGCTCTTCCGGGCCTTTGACGCCAATGATACGGGCAAAATCGAATTCGATGAGCTGTGTGAGATGCTGGCTAGAGTGA
AGCGGGTCAGGAGCTCATCAGTACGAGACATGGCAGAGCTGGCCTTCACCTGGTTCCAAGGAGACCAGAGCGAGGCTGTGTTGACCCATACAGATGCCAA
GCTACTAGCAGTGGCAGTTATGGAGCTTGGAGGTGACAACAAGGTACAGACAGAGCACGGATACGACTTGGTGGCGTCTCTGATGAAGTTGGTGCTGGGA
CGAGACCAGTATCAAGTGACGAAACAGCATTTCTGCCAGCAAATGGACAGCGAACTAGGCGCACACGCACTGCATGTGCTATTGGCACCGTTTGGTGTAG
TAAAAGCACTGCTGGATGAGGAGACGATTCTACAAGAAGTTGACAATACGCGGTGGAAAGCAGGAGATACGGCGTACGTTGTGTCTAGTAGCTGGTGGAC
GCAATGGCGGAGATACGTGCAACCTGATCACTGCAATCATCATTCTCAACAGAATCCGACAAGAAGTAGCACTAACCAGCATGAGCAGGAAGCAGGAGAG
CAACAAGTGCAGGAACAGGAGAGAAATGCTACGCAAGGACAGCACGTTGCGGAGTATCATCCTCGTCCTGGACCTATCACCAACAGGGGTATCTGTGCGA
ACGAACAGCTAGGAACGTTGCGACCAGGTCTTGTTGAAGACGAAGACTTCGTTCTAGTGTCCTCTGCTGTGTGGAAGCGGCTGGTACAAGTGTATGGAGG
TGGACCTGAATTCCCACGACAGATAGTGGAGGTCTCATCATCTGATGAGCAACAGGAAATGCCACCGAGAGAGGAAGACGGAAAGCCAAACGAAAGCACA
GGTGTCGCGTTGGTCTTAAAGTTGGGAAATCAACTCGAACAACGAGTTCAGGTGGACCTGTATCCTGTGGTGTTACAAGTGCGTCTAGCACGACATGACT
CACGGCACGTCTATCTTGTATACTCCCGACGGTTTTTACTGCACCATACTTCATCTCTCAAAGAAATTGTGCATCGTATGGGCATCTTTCCCGGTGTAAA
CGCAAGAGAGGTAACAGTTTGGTTGCGTCGTCGCCGTCTTCAGTCGTGGGCGCGTTTAGAATGCAGTCTAGAAGCCCCACACGCTACGCTTGATGGGTTA
CAGATTACAAGCGCTCAAGAACTGCTTGTGGATTTCCGAGCTCTGGACATTGATGAAAACCCACAAAGCATTGCTCAACAACGTCGACGGAGTAGCATCG
CCAGTTTGGCTCCTCGAACGCCGTTTACTGTGCCCATGCTGCAACCCGTGGGGAATGACTTTGTTTGCTGCCCACGTTCCAGCCTTGCAAAGTTTGCCAA
GACAGGCGATTGGAAGATTCTGCGCGAGAGTATGGCTGCCGAACGGGAAGCAGCTGCCAATGCTTCTGCGGTCTCTGGACACGTCGGTCCTGGAGGAGTA
CTTATTGGTTTCGCCAAGCACATGGAAGCAGCAACAAGGACGTCTCGCGGAAGACTGATTCAACACAACGGTCTACGAGCCACGGGACTCATTAATATGG
GCAACACATGCTTTATGAACAGCGCATTACAGTGCTTTGTTCACTCGCCAATATTTCGCGAGTACTTCTTGTCGAACAGATACGAAGCAGAAGTCAACAA
AAAGAACCACCTCGGCAGTCGTGGTGCAATTGCAGCAGCTTACGCGCAGCTACAGAGCTCTCTTTGGCGCGAGCGTGACCAAGGATACTTACTCCCCGGT
CGTTTTCGAGACGATTTTACGCGTATTCGTCGCCACTTTGAGGAAACGCGCCAATATGACGCACATGAATTCATGGTAGCTCTTCTCGATTGCCTACATG
AAGACCTGAATCAAGGCTGTCCAATGATTGCAGCATCTGCAGATGATGAAATTCAAAACCAAAGCTCAAAATGCTTGACCTTTGGTAGTTTTAACGGTGG
TGGCGACCTGGAAAGCGTTGATGGAGACCAGCAGGTTGACTATGATTCTGCAGATTTATCTTCAGATGACGTTCAAGGCGATGCAGCTTGGAGTGCTTAC
ACAAGTGTAAACTCTTCTGTAGTAGTGGATCTTTTCCACGGACAGATGCGCAGTGAGACCGTGTGCGCTACTTGTGGCGAGCGCAAGTGTACATTCGACC
CGAATCTGTTCTTCAGCTTGCCTATTCCCGAGTCGAGTTTTGTTCGTGTCGAGGTGAGCGTGTTGTTACAAGCGCGAAAGCTCCCAGGTGGTGATGACGA
TGAAAACGACCCGGAAACAGCCCTGCAAAGCGTGCAGCAGGGATTTTGGCTTCGTCGGGGAAGTAATGTGGGAGAGTTATGCGATCGCATCGCAGAAGTT
CACAGCCGAGCTGGTGGGAACCGCTTTTTGCTAGTGGAAGTACGTCGGAATCGGATCAAACGAATTGTTGAGGGAGACGAAGTTGTGGACAGACTGACAA
CGGCTGTACCTGGCTCGCTTTCTGCCTATGAACGTGCTTGGACGCTTGCGGAGATCCCTGTCGTTCCTGCTAGTATACGCGAGTATTTTGACAACGCTAA
CGTCGCTGATGAGGCGAAGACGATTGCAGCTGAGAAGATCAGAAGCTTTTCCGATCTTCGAGTGGGATCACGTGTTGATGCGAGGGATAACCACAATGAC
TGGCATTCCGGTACGGTGATTGACGTAGCTGGAGGCGATGATTCCGAGCAACCCCATCGTGTCTGTGTTCATTTCGATGCGTTTAGCAGTAAGTGGAACA
AGTGGTTTACAGCTCGCGACTGGAAGTCGAAACGTCTACAGCCGCTTGCAACTCGCACGTCGAAGTCGACTGAGGTATTTGAGGTACAAGTTGTTCATCG
CTTTACTTCCCAGCCTTCGTCTGCTACGGCGTCGGAATCCGGCCAGACAAGTGGTGACGATCATTCGTTCACTGGGAACCTTCCTAATTCGCAGAAGCTG
AGCACTTCGAGTTCCCACGAACGCCCGACGTTGAACGTGTTCGGTACGCCGCTATTTGTCACGATTGCATCCGATAAGACTGCTCAAGATATGCACCAGG
CACTTTTCCTACAGACTGCTCGATTTTGGCGAGAGTTTAACGGTGATCCCGAGTCTACTGGCAACCACAGCGACTTGAACCAAACAAAACTACCGTATGA
AGTCCGCGTCGTGAACTTGGAAGACCTAACGAGTGAACGTGGCGAGCCATTACCGACAGACTCAAGCGCGTTGCTGCAGCACTTTTCGACGCGAAGTGTG
CTAGCACTGGACTGGTTTAATGTTCACGACTACTCAAGTTGCGAAGAACGAGCGTCCGATGACGTGCCTGATGAAGTCGTCGAAGCCGCTAAAGCGGATC
CGGACTTGCGCGCTGATCTTGATGCTACTTTATTAAAAGAAACAACAGAGGCAGAAGAGAAGGTGTCAGTGGTAGACGACGATAGTCCACCGATGTATGC
TGTCCCGCTGACCAAGTGCATGGATGCTCTAATGCGCGAAGAAGCTATTTCCCTGGAAGATCACTGGGTCTGTGAGCGCTGTGGTGTTCCTCGTGAAGGC
ACTCGGTTATCTGCAATCTGGCGACTACCAGACTTGGTTATGGTGCAGCTTAAGCGCTTCCAATATCTCGAGAACCAGCACAAGCAGAAGGTTCGCGCAC
TGGTTGACTTCCCGCTTAAAGGTCTGGACTTCTCAAAGTGGATGGGTCATCAGGATGCAGGCTCGTCAGTGTATGATCTCTATGCTGTGGCTAACCATGT
TGGAGGACTCACACGGGGTCATTACACGGCGTATTGCCGCTACGACGCTGACTTCCCGGAGAGCTCCGCGCTCTTAAAAACGAACGAAGAGAGTGGCGAT
GTCCAGTGTCCCGAGCTCTGGTTCCGCTTCGACGACGAAAAAGTATCTGAAATCGCAGCGGGCGACGTGGTCACTGACGCCGCCTACGTCTTGTTTTATA
AGCGCCGCACCCTGTCACCTCACAATGTACTTCGATATGCACTCTAGTAACTATGAGATAGATAAGAAAAAAAAAAAATACTTACAACAATGAGTTTCAA
AGGTGCAA