Transcript Name :
Phypa_INRA-310PPTG_17499
Orientation:
(-)
Number of Exons:
1
Description :
pectin lyase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
HmmSmart predictionP-Valprediction_id
Pectate lyase/Amb allergen3.1SM00656
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Pectate lyase/Amb allergenIPR002022
Y-scoreD-scoreY-pos
0.6240.74826
InsideOutsideTMhelix
1-465
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1642 bases(100 bases per row)
CACGCACATATTGAGTCAAGCTTTGCTTCGAACAAGATCGACAACTATGAGGCCTTGTCGAGTAATTTTACATGCATCTGTCCTAACAGTTCTATTGGCT
ACCCAGTCGATCGCCCAAGGCTTCACCACCGGAGAAGCTCCGGGTTTCGCTGTCGGCACCACCGGTGGAGGAAACGCAATACCCGACCACCCCAAAACGC
TGGACGAACTAAAAGAGCTCCTCCGCGATGATAAGCCGCGCGTTGTCGTGCTTGACAAAGAATTCAACTTCCTCGGATCCGAAGGAAAAACGACCGAAAT
GGGATGCCGACCCAAGTCCAACACGGCCTGCCTCGCCAAGAGCAACGGGTTCAAGGGTCAGGATGTGATTCTCTTTCCAGGTGACACCACGCTCACCCAC
ACAGGAGGGTGTGATCAGCCAGAGAAAGTGGAGATCACGTATGACAACGCCAGCAAGGACATGTTGTCGGTTCGCAGTAACAAGACACTGCGTGGTGTCG
GCAAGAAAGGGGTATTGAAAGGCAAAGGACTCAAGCTCGAGGGTGACAACATCATCATCCAGAATATCCACATCACTGAGCTCAACCCGCAGTATATTTG
GGGAGGAGATGCCTTCTTCATGGGAGGCATCGATAAACGCGCATTGAAGAAAATCTGGATCGACCACGTTAAGGTGTCACGTGTTGGACGGCAGATGTTC
GTCAGTGGTTTTGACGGTGTCGAGAGTATCACGATCAGTAACTCGGACTTCGATGGCCGCACAGACTGGTCGAGTTCGTGTGACGGTCGTCACTACTGGG
GGTTCATTCTGGACGGCACTACTACGCGCGTGAGCTTCCTCCAGAACTACGTCCACTCGACATCGGGCCGTTCACCAAAAATCATCGGTGCGTCAAGTCC
GAATGCAAACGTGGTGGCGCACATTGCCAACAACTACTGGTCCGACAACTCGGGTCATTCGTTTGAGCCAGGGAAGAACGCTTTCGTTCTGGCTGAAGGC
AACTTCTTTGAGGGTACGTTACAGCCCATGGAGGCCGACGCTGAGAAAGCGAGCATCTCGGTGGCGGACGATTGCAGTGCTGCACTGGGTCGTTCGTGTC
CTGGCAACACTGTAGAGAAGAGTGGCAAGTTTGAGTCGGTGAACGGAGCGCGAGCTCTAGAGACGGTGAAGAAGTACAAGGAGATCACGGGATACAAACC
GGGTGAGGCTACTCAGCTATCAGAATCGGCTGATAACTTCGGCGTTGGCACGTTGGGCGATTCACCGTCCCAGGGAGAAGTTAACCAGACGGACGGCTCT
CAACCAGAGGCTAATACCAAGCAAGAGGACCCCGCTCAATCAGAGGCTAATGTCAAGCAAGAGGACCCTACTCCCGCTGCAAATACGAGCGCTACCGGCG
CCCCTAAGACTAATGGTAGCATTACAAAACAAGGCAGTACGTAATAACAGAGACTCACCGTCTCGAGAAGCTGTCGAGCAAGGGATCGTCGCCAAGGATT
TCGAGTCACCGGAAAAGGTTGCTTACATATATACTTACGAGTAGAAGCGTTGTCGTGCTTAATTGACGCTGAAGGGTACGCTTACTACATCTACAATTGC
GTTTAAAAACAAGTTGATGTGAATCAAAAAGCGTAGAAGTCA