Transcript Name :
Phypa_INRA-310PPTG_16032
Orientation:
(+)
Number of Exons:
1
Description :
callose synthase
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7940.87425
InsideOutsideTMhelix
33-462
510-521
582-587
663-1045
1101-1188
2104-2122
2178-2235
2369-2380
2427-2437
1-9
486-489
545-558
611-642
1069-1077
1212-2080
2146-2154
2259-2345
2401-2403
2461-2647
10-32
463-485
490-509
522-544
559-581
588-610
643-662
1046-1068
1078-1100
1189-1211
2081-2103
2123-2145
2155-2177
2236-2258
2346-2368
2381-2400
2404-2426
2438-2460
NN-scoreoddsWeighted Score
0.7913.7790.008
*** None ***
TypeScore
endoplasmic reticulum889
GO
*** None ***
KO ID
K00706
Cluster Id
29
Sequence
        8116 bases(100 bases per row)
GCAGGCCGGCGCTGCCTCTCGTCTCTCTAGAACAAGCTCGCCCACCATGGCGCGCGCTCAGTCGCAACTGACGTGGCTGCTGCTAGCGGCGCTGTTGCTA
TCGGCGACGTGCAAGGCGCTGATGCCCATCACGAACGCGCTGCATCGCGCCCGCCAGAACCTCACGGACTTCCAGCGGCAATGGATTGATCCGGACACTG
ATCCCAAATTCTACAACATATCGGTGCCCAAGGGCGCCTTCAACTTCGGCGGTAACTCGAGTTACAACATTGAGTACAAGCTCATCTTCTCGGACGAGTT
CAACAGTTCCAAACGCACGTTCGAGGCTGGCTTCGACTCAAAATGGACAGCAGTCAACATCCGCGACACCACCAACATGGGGCAGCACTACTTCCTGCCT
CAAGCAGTGCAGATCGACAAGGGCAACCTCATCATCACCACCTCCAAGCCTAAGCAACGCTACCGTGGCACCAAGTATGTCAGCGGTAGCGTGCAGACGT
GGAACAAGTTCTGCTACACCGGCGGATTCGTCGAGGTCAGGGCCATCCTACCTGGCAAGTGGGGCATCCCCGGCACGTGGCCTGCAATCTGGATCATGGG
TAACATTGGCCGTGCGCCGTTCCTTGGCTCACAAGATGGTACGTGGCCTTGGAGCTTCGATGTCTGCGCCCCTTACGTGGAGAAGGTCGAGAAAGTCAAA
CAGAAGATCAACGCCTGTGGCAATCTGACCAACAAACACGACAAGGAGTCATATCCGGAGATGTACGGCTTGAATCCCTTCCAGGGCCGTGGTGCCACGG
AAATTGATGTGATTGAAGCGCAGATTCGTGCTCGTGATCAGCCGGCGTATATTTCCACGTCATTGCAGATTCGTCCCAGTCTGTACGACGATATGCGTCC
GGCTTCAGAGACGCTTCCTGGTCCTGGACAATGGTACCAGGGCCTCAAGTTTGGCGAATTCACGCGTATTAACAGCGACTACTACGGTGAGATGGGTCTC
GACTCCATTTCGGCTCTGACGCAGCTTGAATCCAACGCGTTTAAGGCGTACCACTTATATCGCCTGGACTGGTCGCCCGGTCCCGAAGGTTACATTCGTT
GGTGGCTGGACAACAACTTTCTGTTCGAAATCCCTGGTTCCTCGCTGAACAAGTGGGTAGGCGATGTCCCTCCTCGTCAGATCCCTGTGGAGCCCAGTTA
CCTCATTCTGAGTACAGCCGTCTCGGAGAAGTTCTCCCCGCCGTGCGACGGTCAAATTTGCGACTCGTTGTGGCCCTCAAACTTCACGATCGACTACGTG
CGTGTCTACCAAGGCAACGCGAACCGGTACACGTCAGTGGGATGCAGTCCGGAAGCGTATCCGACGACTGATTGGATTTATGCCCACCCAGTGGAGTACG
GCCTCCCGTGGTACGTTTCGCTACGCGTGGATATTGGTCTCCTGCAAGTTTTTGCAGTGATTAATGCGTTGCTGGGTCTCTTCATGGCGTTCCGGGGAAC
ATCTCATCCAAAGATAATGTCGGCTTACGCAAGCTCGCTGTGGCTGACTGCTTCGTTTTACGGAGCTCTTAGTTCTAGTGCTCCAGAGGACATTGCTTGG
ATCCAAACCGCGCTTGCATGCCTGTGCGGAGTGGTCCTTGGCGGCCTCTGCTGTTTGGTGTACCCGGTTTCTCTTGGAGCGATGCTTGGACTGTACGGCG
GTGTGATGATTAGCCAATTCGTGCCTCTGCTGTCTACGAGAGTGATTACAGCGGTGCTGGTTAGTGTGGGTATCGCTCTGGGATCAGCTCCGCAGATTGA
CACTAAGCACGTCGTGATTATCTCGACCTCGTGGCTTGGTAGTTTGGCGTTTTTGCTGTCGATCTCGCTGTGGGTGAGTGAAGGTGACATTGCCGAGAAT
GCGTGGAATCTCGCTGGTTTCATCTTCAATGGTGATAACGACGACCACGTGGGCTTCTGCACGGAACATTGCCTGACGATGTATGTTCTGCTAGTCGTGC
TGAGTGCAGTCAGCACTACGTATGGATACCTCCGTATGCGTGGTATGTCGCTGCGCAAGAACACGCGTAAGGCCAAATTCCCAGCAGTATCTGCAAGTTC
TGACGCACGGGCTTGGAGACCTGATGATGATGAGGGAATGGAGAAGAGCACAATCAACTTCTTTTCACCGTCGAAGCTGCCGCAGAACATGCAGCAGTTT
AGCACCATTTTTCGCATTGCTGTGAACGTACAGCGCTCGTTTGGCTTCCAACTTGACAACTTCCGCAACCAGACGGAGCATATTGTGGTGCTTCTCACCA
ACAACACGCGTAAGAGTGGCAATCCATACCGCAAGCTGCACGATTTGGTGTTTTCCAACTACAACAACTGGTGCTCGAAGCTTAGGATCCAACCACTAAA
CTGGAGTGAGGAGCGGGCGCCTCAGGGTGGTCTCACGGGTTTGGACGAGATGTCGGTGGACCTGTGTCTGTTTTTCTTCATCTGGGGTGAGGCCAGCAAC
CTGCGTCATTCACCTGAATTCCTGTGCTTCCTGTTCCACAAGATGAAAGAGGAATTCCCGTCCGTTCGTCACTCAGAGCGCGAAGCTGGATACTTTTTGG
ACACGGTGGTAACACCTGTCTACGGGTTGCTGAAGGCTGAAATGACCTCGAAGCACGACCATGAAGATCGCCACAACTACGATGACTTCAACGAGTTCTT
TTGGACGAAGTCGTGCTTGAAGTACGACTACAAGCACGAAGAGGTCATTGATATGACGTCTCCCAACCCGGCTATGATCTACAAACAGAAGCAGCAACAA
CGTCAGGGTCAGGGGCTAGCTGGTCTGGCTGGTCTTGGTGGGCGAGGTGGGCTCAACGGTGGCTCGAATAGCTCGACGTTTTACAACAAGCGTAAAAGTA
TTGCTGAGGGGTTCACCGAGTCGGCGAAGACTTTCGTAGAGAAGCGGACGTGGCTGCTGCCTCTTCGCGCTTTCAACCGCATCTTCAACTTCCACGTGAT
CGCGTTCCACTTCCTGGCAGCGCTTGCGTTCGCGAATGAGCAAGAGATGAATTTCCTGGACTCCTGCAAGATTATTTCGAGCACCCTGATCACTCCTTTC
TTGCTGGACATTCTCCGCGATGGACTCGATATCTTCGCTGTATACGACGAGCACCAGAAGTTGTTCTCGACGGCGCGTAACATTTTGCGTGTGTTCCTGC
ACCTGGGGCTTGCGGTGGTGACTTCAATACTGTACTGGTATGCGTGGGCTTACGGTGGTGCGTGGTGGCAGACGTACTACGTGACCGCAGTGCTTTTCCA
CGTGCCAGGTCTGATTAACTGCGTCATGCAGGTAATGCCTGGTCTTACCAACTGGACCCGACGCACGACGTTTGCTCCTGTCGCATTTATCCGTGACATT
ATGAGTCCGATGAACCGCCTGTATGTTGGTGACAACGTGCTGGACCCGGAATCGATGAGTGTGGGCTATCAGTGCTTCTGGATGTCGCAGCTGGCTTGGA
AGTTATACTTCAGCTACAAGTTTGAAATCTACCCGCTTGTGGTCCCGAGCTTTTTGCTGTATGCTGACCACGTGGAGAACAAGGTGAGCATGATTACGAC
GGTGTTCCTTATCTTCCTGAACTGGATGCCGTTCTTCTTGGTGTTCTGCGTTGATATTACGATTTGGAATTCGATCTGGATGGCGTTCACGGGTACTTTT
GTCGGCTTTTCATCACACATTGGCGAGATTCGCAATTTCACTCGTGTTCGCTCTGCGTTTAGCCGTGCTGTGGATGCTTTTAACGCTAAGGTGATCGCAC
GAAGCTCCAAGACGGGACTCCAACTTTCGGACAGCAATGGTATGTCGTACGGCTCGACAGCCTTGGGACGTGAAGTGCTCGATCGTGTTGCGGGTGGTGC
GGATCCGACGGCCCGAATCCTGTCCCAGCGTCGTACTTCGGCTCATGATGACGAGACTCCGTTGCTGTCTTTCTCACGTCGTAAGCAGACGCCTATGGAG
CGCCAAGCTGCACGTCGTCGCAAGTGGTTCTCATTTTCGGTGGCTTGGGACACAATCATCGATAGTATGCGCGCGGACGATTTGATCTCGAACAAAGAGA
AATCTCTGCTTCAATTTCACCGGCTGGACGGCTACCAGCGTGAGATTTACCTGCCGCAGTTCCAGCTTGCTGGTTGCTTTGAGAACTTCACGTCGAATAT
TCTTGACATTTATTCATCTAATGACGGCAATGTCTCAGAGCGTGTTCTGCAAGACAAGCTGCTGGAAATCCTCAGTGATAACCCAATGGTGGAGGAGTCT
CTCGAAGAGATCTGGGAGCTTGCGAACTGGGTGCTGGTCAATGTGCTTGGTCCCTGCCACGCGAATGATGTGAAGTACATTACAAGTGTGCTCAACTCCT
GGGCGGCACGTGGTGTATTCCGTGCGCTTAACTTGCAAAAGGTGGCTCCGTGTGGCCGCGCTTTGGCGGGATTGATCTCCCTTTTGAAGACCAACGTCCG
TGGCTGGAAGAACAACGCCAAGGTTATCCCTGTGCGCAAGGATCCTTCCGATTACGCATCGTATGAATTCCCGCAACAGTCTAGCTCCTACCGACCATCG
TCGGGAATGACGAAGTCTGCAAGTACGACGGGATTGTCGTCGCTTGGTCTCGAACCTCCTCGCCGTAGTCGTGGTTCTGGAGTCGCTCGTATTGCACGTA
TGCAGCAGCAGACGCACAAGCCGGCCACCAACAATGGCAAGGCCACGCACTCCATCTCGAGCTCTCACATCATGCAGATTCGTGAGCGTGTGCGTACGTT
CTTGAACCTCGGAAAGGAGATTCTGGCACATGTCCACGAACAAGACCCCGTGTTCGCTGAAAGCAAGGGCATTTCGGACCGGTTGACGTGGATCCTGACA
CAGGAGCGTGGTTTCATGTGGGACGACAACTACACTGGAGAGCAGATCACGCTTACAGCGTTTGAAAGCCACACCGACGTGGTGCTATCCCACCTACACG
GACTTTTGACCTTGCAGAAGATTGATGCGGAGCCACAGTCGTACGATGCACGCCGCCGCTTGCTGTTCTTTGTGAACTCGCTCTTCATGGACATGCCACT
GGCGCCGCTGCTTGAGGAAATGAAGTCGTGGAGCGTCATGACTCCGTTCTATGCCGAAGATGTTTTGTACTCCAGAAAAGATCTGGAAAGCAAGCAAGAT
GGTCTGGACGTGCACACGCTGTTGTTCTTGCAGACGCTGTACAAGCGAGACTGGGAGAATTTCTTGGAGCGAGTGAAGCCAAAGAAGAACATTTGGAAGA
ACCCGGAGACTGCAATCGAGCTGCGCATGTGGGCGTCTCTGCGTGGCCAAACACTGTCGCGTACGGTGCAAGGAATGATGTACGGTGAAGCTGCGATTCG
TCTGCTTGCTGAGATCGAACAAGTTCCGCAGCAGAAGCTTGAGGAGCTGATCAACACCAAGTTCACGTACGTTGTCGCCTGTCAGATTTATGGACGTCAG
AAAAAGAACAACGACCCGAAGGCGAGCGATATCGAGTTTTTGCTGCACCGGTTCCCTAACCTTCGCGTAGCTTACATCGACGAGGTCCGTGTGAACTACC
AGAAGGAGCAGTCGTACTTCTCGGTGCTGATCAAGGGCGGTGAGGAACTTGGCTCGGTTCATGAGATCTACCGTGTGCGTCTGCCTGGCAATCCCATCTT
AGGTGAGGGCAAGCCTGAGAACCAGAACGCAGCTATCGTGTTTACGCGCGGTGAGACCCTTCAGACCATCGATATGAACCAAGACGGATATCTTGAGGAG
AATTTGAAAATGCGAAACCTACTGGAAGAGTTTGACAAGGGTACAGCGGACCGGCCGTATACGATTGTGGGTATTCCGGAGCACATTTTCACGGGTAGTG
TGAGTTCGCTGGCAAATTATATGGCGTTGCAGGAGACATCGTTTGTGACACTGAGTCAGCGAACGTTGGCGCGTCCACTGCGTAGCCGTCTGCACTACGG
TCACCCCGATGTGTTCAACAAGCTCTTCTTCATTACACGTGGTGGTATCAGCAAGGCCAGCAAGGGCATCAATCTCAGTGAAGATATCTTCGCTGGCTAC
AACAATTGCATGCGGGGCGGATCTGTGACCTTCCCGGAGTACACGAAGTGCGGCAAGGGACGTGATGTTGGTATGCAGCAGATCTACAAGTTTGAGGCTA
AGTTGGCGCAGGGTGCTGCGGAGCAGTCACTGTCGCGTGATGTGTATCGCATTAGCCAACGTCTCGACTTCTTCAAGCTGCTATCATTCTACTACAATCA
CGTGGGCTTCTACCTGTCGATGTCGATCATCATCTGGACAGTGTACATCCTGCTGTATTGCAACCTGCTTCGATCGTTGCTTTCGGTGGAGGGTGTTGGC
GGTAGGGAGCCAGTGTTGTTGAGCAAGTTGCAGTTGATGCTCGGATCTGTCGCGTTCTTCACTACTGCGCCGCTGCTGGCGACGATTTCGGTTGAGCGTG
GCTTTAAGGCCGCGCTGAACGAGATCATCGTCCTCTTCGTGACCGGTGGTCCGCTGTACTTCCTGTTCCACATTGGCACGAAATGGTTCTACTTTGGACA
GACGATTCTTGCTGGTGGTGCCAAGTACCGTGCGACGGGCCGTGGTTTCGTGACGAAGCACTCGTCATTCGACGAGCTCTACCGCTTCTACGCAAGCAGT
CACTTATATGCTGCAGTGGAGATCGCGATTGGTCTTACGCTTTACTACAAGTTCACTGTCGGCTATCAGTACTTCTCGATGACATGGTCACTGTGGCTTG
TGTTCGTGTCTTGGTATTGGTCGCCGTTCTGGTTCAACCCGCTGGCGTTCGAGTGGTCTGACGTGATGGAGGATTTCCGGTTGTGGTTCAAGTGGATGCG
TGGTGATGGTGGTAACCCAGATCAATCGTGGGAGGCTTGGTTCAAGGAGGAGAATGCGTACTTCTCGACTCTTCGCCCGTGGTCTAAGGCATGCATCACG
ACTAAGGGCGCGTTGTTCGCGTTGATCGCTGTTTCTATCTCTTCAACGAGCGACGAATATCACTCGATCTTGACGGAAACCACATGGCTCCCGCTGGTTA
TCTGCTTATCTATGGCCGCGGTGTATCTAAGTGCAGAGGCTGTCTTCTTTTCCTCGTCGCGTTCAGGTGAGAGTGGAGTTGTCCGCTTTCTGAAGCTCAT
TTTGGTGATCGTCCTGGGTGCTGGTCTTATTTTCGCCTTCATCTACGTGGACGGTATGTGGCAGATGCTGCTGAGCATGGGATATCTCGCTGCGGCTGTC
GGTTGCTGGGCGCTTGTGCTTCTTGGCAGCAATTCGCGCCTTGTTGGTACCCTTTACTTTGTGCACGATGCCGTACTGGGTCTGGTGTCGCTTAGTCTCA
TCCTGCTGCTCTCGGCACTTTACGTTCCCGGCAAAATCCAGACGTGGCTTCTGTACAATAATGCTCTAAGTCGTGGTGTGGTGATCGAGGACATTCTACG
AGCGAACTCGAGCAATGACGAACGCGACGATGATCTGTCGGTGCAGCAGATGCGCTCGATCATCATCGAGCAGCAGCGGTTTATCAACGCTCTGACTGCT
AGCGGCAGCGAGACTGACATTCGCGCTGCTGGAAAGAAGGATGATCTCATGCACGCTATGAGTGATAACACGCTCAACGCAGTACTGAGGAATATGTCAG
AATCGGAGCTGAGCGCGCTGCAAGACTCGTCCATTCGCCTTCAGGCCATCATGTCGGAGGAGGAGCGCAAGGTCGCCCAACGCAAACAACAACAGGAAGA
GCAGAGACTCGCCGAGGCTGGCATGAACTCGTCCCTATCGCGCACGCGTCGAGCCTTCTCCACGAGCGATTTCTCCGCTATTCCACTGAATGCTAGCCCC
TACAATCTCCCCAACCAGGATGGCACAGCTGCACCCAGCACTCGCACCACTAACGGTTCTGCTGCTCACGGACCTCAAGCTGGAGTATAGGAGTAGATAC
GCAAACTTTGTTAGATGAATACGTTGGTAGAGCGAGGAGCCCATTGCGGCCAATTTGCATTTTGATAATGAACTACCTTCTGTTCAAACGTTTGGCAACA
CACAATTCAATTCCGG