Transcript Name :
Phypa_INRA-310PPTG_15328
Orientation:
(+)
Number of Exons:
1
Description :
phospholipid-transporting ATPase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Cation-transporting P-type ATPase6.9PR00119
Cation-transporting P-type ATPase6.9PR00119
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-154
199-388
459-985
1040-1068
1126-1131
1192-1391
173-175
412-435
1006-1019
1092-1105
1155-1168
155-172
176-198
389-411
436-458
986-1005
1020-1039
1069-1091
1106-1125
1132-1154
1169-1191
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
cation transportGO:0006812IEA
*** None ***
Cluster Id
12
Sequence
        4542 bases(100 bases per row)
GTCACAAATAGACCCGCCGTGACTTGTGGCGGCGCTCGCCTTGGGACTCCTCCAGCACCCAGCACAGCAGCATAGAATAGCTTTATAAGCCTTTGGAACA
GGACGCGCTCATGGCTGCCAAGCGCAGCACGTCGCGCATCTTCCGCGGCTCGCGGGTGGAGGACCAGGTGGCGCTGTGCTCCAGCGTCGCGCCCGCACGC
GACGATCCCGCGCTGTCGGACCAAAGCGACAACGTTTTAGGCTCCAGTACCAGCGGTTACAACACTCTGGGCAGTCCAGCACTGCTCCAGTCTCCCAGAC
AGACACGACGCACGAGCCAACAGACGAAAGAGCAGCTTCTGGACGAGGACGAACTCGTGGACTACGCGTCCCAGAGCACGCCCGCATCTTCAGGTAGTGG
CGCACCAGGAGCAGCGACAGCAGCCCCAGGCCCAGAGGAGACACTGCGAGAGGTCTATTTCAACTATGCACCTGGCAACGCTGTGTTCGACAAATGCTCG
AACGTCGTGGTGACGTCCAAGTACAACTTGGCCACTTTTTTCCCTAAATTTCTCAAGGAAAGCTTCACTAAGGTGGCCAATTTCTTCTTCCTCATGGTCT
GCGTGCTGCAGAGTATCCCTAGTATCAGTAACACGTACGGCTACCCGACCAACGCGCCGGTCTTGTTCTTCGTCATCTCGATCGACGCCGTGTTCGCCGT
CATGGAGGATTTACGACGCCACAAATCGGATAATGAGGCCAACTCGGCCATATGCCACGTAATCCAGGACGGTCAGGTCGTGGACAGGAAGTGGGCGGAC
ATTAAAGTCGGAGATTTCCTACAGATCCGCAACCGGGAAGTCATCCCGGCCGACGTGCTGGTGCTCGCCGTGTCAGAGCCCGTGGGCGAGCCGCCCAGCG
GCATCTGCTACGTCGAGACCAAGAGTCTGGACGGCGAGACGAACCTCAAGCTGCGCCAGGCGGTGGCCGCGACCATGAGCTCGCTCGCGAACGCCGCCGA
GCTGGCGCTGCTGCGCGGCGTCGTTAAGTGCGAACAGCCCAATCCGCACATCAATAAGTTCGCAGGCAAAGTGGAGGTCACAGTGGGCGACGGTTGCGGC
GTGGAGGTGATGCCGTTATCAGTTAAGAACGTGCTGTTACGAGGTTGCAATCTGCGCAATACCGACTGGGTTTTTGGACTAGTGTTGAATACCGGTAACG
ATACCAAGATCATGCAGAGTGCCAGTGCCGCTCCGTCCAAATGGAGCGACTTGATGCTGAATATCAACCGGATGATCGTCATTCTGTGTCTGGGGCTGTT
TGTCGCCTGCGCCATGGCTGCAACCTGCTACATTACGTGGCAGTACGACATTGTACGCAACGCGTGGTACATTCAACTGACGGAAACCGAGAGGAACCGC
ACGCGTCTCGTGGCGTTTATCCAGATGTTGTTCTACTATTTCTTGCTGTTGTATCAGGTGATCCCCATCTCGCTCTATGTGTCCATGACAAGTGTCAAAT
TCTTACAGTCGCGCTTCATGTCGTGGGACCTCGAAATGTACCATGCTGAAACGGACACACCTGCCATCGTCCGGACGATGGAGCTGAACGAAGAACTGGG
CCAGATCTCGTACGTTTTCAGTGACAAAACTGGTACACTTACGTGCAACATCATGGAGTTCCGTAAGTGTTCCATAAACGGTATTTCGTACGGCTCCGGT
ATCACGGAAATCGGTCGTGCCGCACTGGTTCGAGCTGGTAAACCGATCCCGCCAGAGCCTAAACTGGACCCGAGTATCAAGAAGATTCCGTTCGTGAATT
TCGTGGATAAATCTCTATTTGACAGTATGAAAGGTAGTGCAGGAGAAGAGCAGAAGGAGAAGATCATGCAGTTTTTCGAACATCTCGCAGTGTGCCACAC
TGTGATCCCAGAGAAGCTCGAATCCGGCGAAGTTCGACTATCCGCGTCGTCTCCTGATGAACAGGCTCTTGTGGCAGGTGCAGCCTTTGCAGGGTTCAAG
TTTGAGAGTCGTAGTGTTGGTACAGCGATGGTGGAGGTTCTGGGACAACGTGTGACCTACGAAGTGCTGGACGTGCTCGAATTCAACAGTACGCGTAAGC
GTATGTCCGTCGTGGTGCGTAAACCCAGCGGAGAGTTACTTCTGTACACGAAAGGAGCCGATATGATGATCTATCAGCGTTTAAAAGACGACCCGGCGAT
GCTCAAACTCAAAAACATCACACGAGATCACATGGAAAAATACGCAGACGATGGATTACGAACACTGGCGCTTGCAGTCAAGAAGCTGGACGAGCGTTGG
TTCCAGCAGTGGAAGATGCGGTTCGACGATGTACAGGGTAACGTGGCTGAGATTGATCGACGAAAAGACGGTAAACCGAACGCTATCGACGACCTGATGG
AGGAGATTGAAGAAGGTCTGGAGCTTATTGGGGCCACAGCTATCGAAGACAAACTTCAGGACGGAGTACCGCAGTGTCTGGCTAACTTGACGCGGGCGGG
TATTAAAGTGTGGATGCTTACAGGCGACAAGGAAGAAACGGCTATCAACATCTCGTACGCCTGTTCTCTGCTTGACAACTCGATCCAACAGGTCATAGTG
AACGCCACTACATGTCCAGACGAGGCAGCGATCCGTGCAAAACTGAATGCTGCAGCCAGAGAGTTTTTAGACAGTGCCAAGGGGATGGCAGGTGGCAGTG
AGAAGGAGATCTCGTTGATTATCGACGGCGAAGCACTGGAAATGGCTCTGCGACCAGGAACGGCGCCACACTTGTTGTCCTTTGCGAAGCTGTGTCGCGC
CGTGATCTGTAACCGAGTGTCTCCTGCTCAGAAGGCAGAGATGGTCAAGCTGGTCAGAGATAACATCACAACAGTACGGACACTAGCGATTGGCGATGGA
GCTAACGATGTAGCCATGATTCAAGCTGCTCACGTGGGTGTGGGTATCTCAGGACAGGAAGGAATGCAGGCTGTCAACTCTAGTGACTACGCTATCGCCC
AGTTCCGCTTCCTGGAGCGATTACTATTGGTTCACGGACGTTGGAACTACATTCGTATCTCGAAACTGGTACTCTACATGTTCTACAAGAACATCACGCT
AGTACTGGCGCAATACTGGTACGGCTATCTGTCCGGCGCTTCTGGCTCGAAAATGTACTGGGAGATCGGCGTCCAGCTGTACAACATCGCATTCACAGGT
CTCCCTATCGTGGTCGTGGGTGTTCTGGACAAGGACCTACCAGCTCCATTCAGTATCGAATATCCAGACTTATACCGTCGGGGACCGGAGCGCTTCTTCT
TCAACATGTACACGTTCTGCCGCTGGATCGCAGCAGCCTTCTATGAATCTTTGATCATCTTCGTGGTCATGTCATATGGCTTCAATGCATCGGAGAAAGG
GGCAGGCAGTGAGTCCCGTGTGGAGTTCGGTATGGTCGCGTTTTCACTAACTGTTCTCATCGTGAACATCAAGATCTGGATGATCGCAGACCGATGGACG
GTGCTGTCGTTCTCGCTCTGGTTCGGTAGTGTCATGTCGTGGTTCGCCTTCGCTGCTATTGGAACGGAAACGCCCTACTTTGCCACATTTAAGATTGGAT
ACGACGAGTTCGGTGCGTTTGCCCCCACTGCCAAAACGTGGGGGTATTTCCTGGTCCTCATCATGGGATGTTCACTGGCTCTTGGACGGCACATCGCGTA
CAATCTGTACCAGCGGACATTCCATCCGGATCTGGCTCAACTTCTACAGGAGTCCATGGGTGGAGGTTCGCAACGCAAATACCAGCGACGTCTGACTATT
AACCACATGGAAGAACAGACACTGTCCATGTCGTTGGATGATGTTCACACTACCGGTTATTTGAGCGACTTTGGCCACTCGGACGCTGAGATTCTCAAGG
CTCAACACCCACAGAGCTTCGCAGCGACACTGTATGAACAGCAACCCAAGAAGAGCGGGTCAAATGTTGGTACATCTACGCTCCAGTCGACGAACTCGAA
TATTACCGACAGTTACTCGGCCAGTGTATTCAGCGAATCGATCTCAGAGGACGCGACGTGGGAACGAGTACCGCCCAAGATGCTTCGCGCGACCACAGGC
CGTCGCAACACTGGCTTTGCCTTTAGTTGCGACGAGGAGACGACGTTGGCCGAGTCGTACATCGCCTCGAACTCGTTGCCACGCTCGGACGCCATCTCGA
CTGCCATGCGCAACTCCTCGACTAGTTCAACAGGAGGCACCAGCGCGCGTCGCGTCTCCATGGGCCGCGTGCGCTTGCTGTCTTAGAACGGCGTATTCTA
ACCTAAAATCCTGCAGAATGCAGGCTACATCGCTCGAAAGTTCCGACAACTGGCCACGAAACAACTCGTTTTCTAGCTCGACATGGACCCAAGCACCGCA
CGTGCTGTGATTGCCACCAGTAGAGCACTGTATTTAAGAGTGATCTGGCCAAGATAAGGAACAATGCTTGTCTTTCTTGTGGAGTGTTATCCTTTTTTTT
TTCTGGGTGTGATGGTCGTGAAGTTGCCTTTTTCAATACAAC