Transcript Name :
Phypa_INRA-310PPTG_14759
Orientation:
(+)
Number of Exons:
4
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
WD40 repeat16.691PS50082
WD40-repeat-containing domain15.03PS50294
WD40-repeat-containing domain13.29PS50294
WD40 repeat9.105PS50082
HmmSmart predictionP-Valprediction_id
BOP1, N-terminal domain4.1SM01035
WD40 repeat5.5SM00320
WD40 repeat23SM00320
WD40 repeat230SM00320
WD40 repeat130SM00320
WD40 repeat9.3SM00320
WD40 repeat1.8SM00320
WD40 repeat5.9SM00320
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-825
*** None ***
*** None ***
TypeScore
cytoplasmic565
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
rRNA processingGO:0006364IEA
*** None ***
Cluster Id
2155
Sequence
        2978 bases(100 bases per row)
AGCGCGTCAGTGTCAATAGCGATGGCTCGCGGGAAGAAGACGGCAGCGCCGCTCAAGGCGTCCACGCCCAATGCCAATGGCGGCAACAAGGGCAACAAGA
AGACGGCGGGTATTGCAGCGAAGAAGCAGAACAAACAGCAGGTGCAGACGCCTGTCAAGAGCAACAAACAACCCGTGAAGGTCGTGAAGCAGCCTGTAAA
GGAAGAGGGCGAAAATGAGGAGGAGGTCGACGATGAGGCTAGCGAGACGGAGGACAGCGATGAGGCTAGCGATAGTGACGAAGATGATGGCGAGGGCAGC
GACGAGTTTGAAGATCAGGGGTCATCCTCCGACGATGACAGTGGTGACGAGGAGAGCGACGACGACGCTGAGCTCACTGAGCTTGAGAAGAAGACGCGTC
GCTTCACGGTGGATCGCGAGAAAGAGATGCAAAAGATGCGCGAGGATGGATCGCTTTCAGTGGCGTCGCAGCTACACGTGGACGATCTGTCGTCTGACGA
TGAAGAGAATGTCAACACCATTGGTAACGTACCGCTCCGGTGGTACGAGGACTACGACCACATCGGTTACAATGTGGACGGCAAGAAGATCATGAAATCG
AACAATGGTGACGGCATTGACGACGCTATCGCTGCTAAGGATGACCCATACTATGAGTACGTCGACGTAGATGGTCACTATTAGGTTGAAGGAGGCTGAC
ATTGTATTGCACTTTGTTGTTTGACAGCCGCACGGTGTACGACGCGTACAATGACCGCAAAATTGTCATTTCGGACCGCGACATGGAGATTATTCGTCGT
ATGCAGGCTGGTGCTTTCGCACACCCGGAGTTCGAGGCCTACCCGGACTACGTTGACATTTACTCCTCGAACACAATCATCCACGCTATGGGTAACGACC
TTGAGCCCAAGAGCCGATTCCTTCCTTCGAAATGGGAGCGCATGAAGGTTATGAAGATTATGAAGGGTATTAAGGAAGGTCGCATCAAACTAGACCAGGA
ACCCGAAAAGAAGCCCGAAGTCTACCAGATGTGGTTTGACGACGACCAGGCGCAGACTCGCAAGGGTCCGGCCCACGTGCAGGCTCCGAAGATGCCGCTT
CCTGGACACATTGAGTCCTACAACCCTCCGGATGAGTACTTGTTTACCAAGGAGGAGCGTCGCGCTTGGGAAGAAGCCGAACCGGAGGACCGTGACACGA
ACTTCATCCCAAAGAAGTTCAAGTCGCTGCGTGAGGTGTGCGGCTACGGCGGCTTCGTGCGTGAGCGTTTTGAGCGCTGCCTGGATCTGTACTTGGCGCC
TCGCGTTAACAAGCGCAAGCTTAACATTGACCCGGAGTCGCTCGTGCCGGAGCTACCGAAGCCTCAGGATCTGCGTCCGTTTCCCAACACATTGGAGCTT
GTGTTCAAGGGCCACACTGGCCGTATTCGTTCGCTGGCTGTAGACCCGTACGGCCAGTACGTGGCCTCAGGTTCGGACGACTTCACTGTTCGTATTTGGG
AGCTTGAGACTGCGCGTTGCCTGCATGTGTACAACGTTGGTGCTGTGGTGCACAAGCTGTCATGGAACCCGAACAAGGACCACCAGTTGCTGGCTGTGGC
TGCTGCCAAGAAGGTCTTTATCATTGCTACCGGAACAGGTAGCGCAGACCAGACGGAACTCACCAATGCGCTTGTGGGTGATGCCAGTGACAGCATTCAG
ACTTCCAATGATGATGATGGCAAGACAGATAGCGCCAGTGGGGACGTCCAGGTCGTGGATGAGGATGAAGCCACTGTGGAGGCTGACGCGCTCAAGAAGA
AGGTGCCGGTAACCTGGCGGTTCTACAGCGGCACCAAGGACAAGCACAAGTCAAAGAAGGCGGATCGGCCGTGGCTGGAGCGTCGTGTGGGCACTGGTAT
TCGTGTTGTGCTGCACCACACGAGCGACGTGAAGGACGTGGCATGGCACTACAAGGGTGACTACCTTTCGACGGTTGCTCCTGGCGCTGGTGCCGGAGCA
GTGCTGATTCACCAGCTCTCGAAGAGGAAGACTCAGAACCCGTTCCAGAAGAGCGTGGGTCAGGTGCAGTGCGTGTTGTTCCACCCGTCCAAGCCATTCT
TCTTCCACGCTACCCAGCGCCACGTGCGTGTGTACAACTTAGTGAAGCAGTCGATCGTCAAGAAGCTGTCTTCAGGTGTCAAGTGGATCTCGAGCATGGC
GGTGCATCCGAACGGTGACCACTTGCTAGTAGGAAGTTACGACCGGCGGTTGTGCTGGTTTGATCTGGATCTGTCTTCGAGGCCATTCAAGACACTCAAG
TACCATGAGAAGGCTGTGCGCGACGTGTCGTTCCACGCCAAGTACCCGCTCATGGCTTCAGCCTCGGACGACGGCACCATTCACATTTTCCACGCCATGG
TCTACTCGTACGTATCGATGGCATTTTTTACTGACACGAAACGATTGAGTTCACTAACTGTGATGAACGTGTGACCTTTGCAGGGACCTGATGAAGAACC
CGCTGATCGTGCCGCTCAAGATCCTGCGCGGCCATGAGGTCTCTGGTGGTCTCGGTGTCATGGCGCTAGCCTTCCACCCTGTCCTGGTACGTGTTTCATT
TCATGTAGAGAATAATGCATCGTCCGTTCTAACTCCTGCTTTCAATTTTTCGTGTTTGCTTCGTAGCCATGGGTGGTTACAGGCGGTGCCGACGGCTCCA
TTCGCCTCTTCCAGAACATTCACTAACTCGCTCATTGTAGCGGGCTCGACGATCCGAGCAACCATCCGAGTGGTCGGCAAGGCAACGCTCCGTTTGTTGG
AAACTTCAGTGCCTGTCGAAGCCAGCAACTCGTAACTGTGACGATTCAATAATAGACAACGTGCATACGGATATCGGATCACACCGTTTCTGGCGGCTCC
TTTAAAAGATACACATTCGTGGAAAATATAATTGCGGCGACCATGGCGAACAGCAAATTGCTCGGCACATGATGACGG