Transcript Name :
Phypa_INRA-310PPTG_14720
Orientation:
(+)
Number of Exons:
3
Description :
myosin-like protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ankyrin repeat6.3PR01415
Ankyrin repeat6.3PR01415
Profile scan predictionP-Valprediction_id
BTB/POZ-like12.04PS50097
Ankyrin repeat-containing domain57.299PS50297
Ankyrin repeat12.235PS50088
Ankyrin repeat14.88PS50088
Ankyrin repeat12.182PS50088
Ankyrin repeat9.03PS50088
Ankyrin repeat11.514PS50088
Zinc finger, FYVE-related13.341PS50178
PDZ domain9.652PS50106
HmmSmart predictionP-Valprediction_id
BTB/POZ-like6.9SM00225
Ankyrin repeat900SM00248
Ankyrin repeat210SM00248
Ankyrin repeat1.5SM00248
Ankyrin repeat12SM00248
Ankyrin repeat2.1SM00248
Ankyrin repeat88SM00248
Ankyrin repeat6.3SM00248
Ankyrin repeat0.0045SM00248
Ankyrin repeat0.0027SM00248
FYVE zinc finger7SM00064
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Zinc finger, FYVE-relatedIPR017455
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-1388
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
metal ion bindingGO:0046872IEA
*** None ***
Cluster Id
796
Sequence
        4582 bases(100 bases per row)
ATGGCTGAGGTGGACAGTCTGGTGTCGGACCTGCTGCAGGTGAGGAAGCTGTTCGCGAACAACCACCTTAGCGACGTTCTGTTCATCTTCACGTCGGACT
CTGGCGGTTCTCCTGCGTCTGACGGGGGCGAGAACGACAAAAGCTCGACAGCAGGAGACCACCTTATCCCAGCACATCGGCTTGTGCTGTCGCTACGTAG
CGGTGCATTCCAGACGGCATTGCTAAAAGCGAAAAGCAGCCAAGTGCCGGGTCAGGTGCGATTCCCACTGAAGATTCACGTGCAGGATACGCCCTACCGC
GTATTTTATTCGCTGCTGAGGTTCTTGTACACGAACGATCTTGGTGCAGAGGGGGAAGATGGAGGCAAGCGAGGCCGAGAGGAATTCTGGCAACAGCTGC
TGCGAGCAGCGTTCGTATATCTGGTTCCATCGTTGGTCGATATTTGTGTCAAGAGAATTACAAGCTTCTTAGAACTGGAAAGTGATAAAGTGGAGGAGGA
AAAGGTAGAGGAGGAGTGTGAAGATGCCGAGGAGCGGAAGCGACGGTTGCAAAAGAAGACGCTGGATGTGTTGGTGTTTATGGACACAGTGTTGGCGACA
TACCCGTTGACTGCTAGACGAAGAGAACCGTCGGATTCGCATACGATAACCCCGCCACCGTCGCAAAATGGACGTCGGTCTACTGGTGACGGGAGTGATG
CTGGCAGCTCAGTGCTGTCACGATGCGCCGAGGCTGTGTGTCAACTGCAGAGCATGTGCTTGAAGCAGCTTCAGCACATGGATGAAGCTGCGTTCGAGGA
ATTATTGCAGAGTGACACTGGACGGCAATGTTCTACAGAGAGATTGTGCGAAATCTTGAGAATGCGATCAGATACGCCGCTGGTTGTGGCAATCCGATAT
CAGCTTGGTCGTGTGGTAAACGAGCTTCTGCTACTGGGAGAACCTTTGGATCAAGTCGGAGGCGATGAGATTGATTTGCCGCTTGTTGCAGCACTGAAGA
CTGGGAACAACGCGATTATTCGCCGCCTGCTTGTCGACGAAAGCGCGCCGTTCTTCCTGCTCACCGACAAAGTTCCGTTAATATTTTTGGCCAGCGCGAG
TGGAAATGTGCAGCACTGCGATATCCTAATTGAACAGAACGCTGCTGATGTAAATCTGATCTCTCAGCTGAAGGACGGTGACAAGGAGATTACTGCAGAA
TTTGGGCACCAACAGACCCCGCTACATATTGCCTGTCGAAAGGGCCACAGTGCGGTGGCGGAACTATTGCTACAACACAATGCCGCTTCTAATTTGCCTG
ACGAGGAAGGGAATACGGCTCTACACTACGCTTCAAACATCGAGACTGTTGAAGTGCTGCTGAATAGTGCATTCAGAACGAATGCCAACATTCCAAACAG
GCGAGGACGGACACCATTGCACATTGCTGCAGCACGAGGAGACGTCGCTGTGGTTGCATATCTGATCCGTCATGGTGCAGAGCAAGACATTGTGGATGAT
CAAGGGCAAAACGCGTTTCATCATGCTGCTGCAAACGGCCACACAGCGGTCACTCTTGTTCTGCTCCACGAGAACGAAGCTGCTATGGCAAATGCAAAAA
AACTGGTAATAACTAGCGAGAGCAATGGAACGACAGAAAATACTCACTCTGAAGATTCACAGCAAATGAAGCAAACCGGTGGTGGCGAAATTGACAGCGC
AGAAGAGAACGGAGAAAAACGAGAAGAACCAAACGGATTTGATATTAACAGGGAAGACTTGAAGGGCAACACTGCTCTTCACCTCGCTGCCATGTCCCCA
TCCGAGCGGTGTCAGAAAATGCTGCAATTATTGCTGGAGAATGGCGCAGATCCGAACCGGGCGAACTGGTTTGGATACACTGCGCTTCATTTGCTTTGTT
CGCACCAAAACGGACCGGCGTCACTAATCAACGCATTTGTAAGTGGCCAAAGTTTCGCTAGCACCATATTGATATGTAACTCTAATTTGTGATTACTATA
TTATGTTTGTTTGCTATCCAGATTGAGCACGGTGCAAATATCCACGCGCAGAGCTTAGACGGTAGTACTGCATTGCATCTGGCTGTAGGTCGAGGAAGCG
AAGACGTTGCAGTCGCACTGGTAAGTGCCGGTGCCTTCGTGCACCTGTTGGACGCAGCAGGACGCAGCGTGGTGGACTTGGTGGAGAACACGAACCAGGG
ATCGATGCTAGTGCCAGTGCTACGCAACCTGTCGCACCCACCCGAGTGGGTGGGTGACGAGCAGACCACCGAGTGTTCATCGTGCCATACAACCTTCCGA
CTAGCCATGCGCAAACACCATTGCCGCCACTGCGGTCGCACCGTGTGCTACAACTGCTCCAGCAACAAGATCACCATCCCAAAGTTCCAAGTACTTAAAC
CCGACCGAGTTTGCGATACCTGCTTCGACGTATTGTCCTTCCGGAAGCTATTGTAAAAATTCGCAAATCAAACATCTTCAAGATATTCCCAGATGGCTAC
ATTTTTTCTTCCGTTGACAGATGTCCGTTTTCTTATTGGCTAATATTCTCGATAATTTGCCATGGGTGGTCATTTCAAGAATAGGTCCAGCAGCTCCAAG
ACTTTCCCACCGGCCGTGTGTGCACGCCGCTCTATTGCCGTCTCGAGCTGCCACTGCTCCCTACTGTTGCTATGGCCTCACCGGGTGAGGCTCCACCACC
TGCACCCGCGTCGATTGCAGCTGGAAATCCTTCACAGGCGCGGAGCAATGGCGACGAGTTTTTTGTCACTGCGAACCTCGTGGGTGCCGCACTACGCTGC
GTCGTGAATCCACAATGGCCGTGCGAGGCACTCCTAGGTGCGGCAGCTGAAGCCTATCACGCCAATTTTCCGAACAGCGAAGTTCCCGAGTGTAACGTGG
TGTTTCACCGTAAAAAGCAGGAGTTTTTGGTGGCTGGAACGCCAATTAACGAGTGCTGTGCAAGGGGAGATGAATTGGAGCTGGGTGTGACCGTCCCGGC
CCACGGTGCTACTCACGTTGATGCTACGCCATCCGTTGCTGTCAGTAGTGTCAGTGGTGTGGACAGTGATGGAGAGACCAGTGAGTTCTGTGTGTTGTTT
CACAAGCTTCCATTGGGGTTTACGATGAAACGTGGACATGACAGCAGTACGGAGGTGGGAACCATTTATCCCAAGAGTGCAGCGACCCATTTCCCTCGGC
TGACACCTGGTGTCACCATCGTGAGCATTGCGGGGACGCCACTAGAGGACATGGGTCTTCGTCAGGTGCACGATTTGATCAAGAACGCTGGTCTCCCATT
GGAGATTCATTTTCGTGGACCTGAACTAATGGTGCCTCCATCGTCGCCTAATCCCGCACAGCAGCAGCAAGAACGGTTGTCGGCCTCGGCTGTAATACCC
CCTCCTCATCCTCAGCAACAGGGAAGACGTCGCAGAGGGTCTTTTGATCGCCGTAGTGTGCGGAGCAACGGTAGCAATGGAAGTGGTCGCAGTCGTAACA
GTCGTGGCAGTCGTGGAAGGAAGAAAGGTGATTCTACTGAACACAAGGGTGCTGACAACCAGCAGAAGGGGGAAGGTGGTAAAACACGTATACAAGCAGC
AGGGCACCGCGATGCAAGCGATTCAAACCAGCGCAGCGGACCAGAGGAGCATGATGCGGATCACAACACCGAAGCTGATCTGGTCGAGCAAATCGAACAG
CTTAAGGTGGCTTTACTACGCAAGCACGAAGAAGCCAAGCAAATCGCGCGTCTGCTCGAGACGTGCTCCGAGAAACTACTAGCTCTACGTGGCGAATCTG
GTGGCATGGCAACATCTCATCAACAGCAACAAAGGCAACAGCCCAAGCAAAATGGCACCCCTCGTTCACGTCGTAGTGGAGCACCTCCATCGAATAATGG
TGGTTCCAAGGTTCGACTGACGCCTGAGGTTCTAGAGGCCATGGATCAGAAAGCTGGCCTTCCTCGACGTGGCACAGGCGCGTATGCTTCATCGAACGTG
TCATCAGTCTCGGGGTATTCAGCTCAATCCATGCCAGTAGCTCGCTCTGGGAGTATGCGAGCGCGCAATGCTCGTGCCGCGGCTCTCGCCAATGCCGACA
ACGTGTCAGTATCGTCCTATACATCGAACTCATCGAACACATCTGCACGCCGCGGTGGCAACCACTTGAATAAACGGTACAACTACATACCGCAGAAGTA
TGCAACAAGCACAACGGGAACTTCAGAGGCTGGGTCGACTTCTCTGTCATCTCGTGGAGCTGTGATGTCGCGTGCGCGGATCTCGCGTGACTCGTTCATT
ACCAAGAGTGAGAGTCCAGGTGTCGGCTACTACGACGTGCAGGTCAAGGATCGCGTCAAAGGTGGTGAGATCGGCGACTCGGACCGCTCGTTACCGTGGT
CTTGAGTGTTGGATACCTCAACTGGAGATTACGTAGCACTGGCATTTGTCTCTCCTTATAAAGTACGCATCGATAGAGCATTGAAAGTGTTCCCGCGTTA
GCTTGGCAGTCAAGTTGTTGGCTGCATCAATTCAACTCAACTCAATAGACATAGTCTCACATAAGTATTGTTTGATGGCATC