Transcript Name :
Phypa_INRA-310PPTG_14755
Orientation:
(+)
Number of Exons:
1
Description :
GPI ethanolamine phosphate transferase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-4
522-527
614-654
705-740
836-855
921-936
999-1020
28-498
551-590
678-681
764-812
879-897
960-978
5-27
499-521
528-550
591-613
655-677
682-704
741-763
813-835
856-878
898-920
937-959
979-998
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        3185 bases(100 bases per row)
TACAAGTTTTCTAATCGACTCACTCCTGGTGAAGGTGGCGACGGAAGACCCGGCTCGTACAGAAAGGCTCGAACATGTGCAGCAGCATCGCCCGCCTGCT
CCTGCTGGGTGTGGCGTTCCATGCGCTATGCATCCTCAGCGTTTTCGACATCTACTTCCAGTCGACTGTCGAGTCCTCCATTTACAGCGCCAACTACACC
TCGTCGCCTCCAGCCAAGCGCGTCATCATCTTCACATTCGACGGCTGTCGCGTCGACAAACTCTTCAAAGTCGTTGCCGGCAACGTAAACCACTACGACC
TCAACCCGAACGGCTCTACAAACACCACCAACTTCAGCTCCGACAGTCGTGTGCCTTTCCTAGGCGTTGTAATGCGAAATCGCGGCAGTTGGGGCGTCTC
ACACAACCACGCACCTACCGAAAGTCGGGCATGTCACGTGGCGCTAACTGCCGGAATGTATGAGGACCCACACGCCGTCTCTAATAGCTGGAAGCGGCAC
CCAGTGCCCTTCGACTCCGTCTTCAATCAGAGCAATAATGCCTTCATCTTTGGTAATAAAGACGTCGCCCCGATCCTCGCAGCTCATGCACCACAAGCTG
TGGAAAAGCACTATTCTGCGAGAGAGGAAGGCAACATGGTACGCGAAGATACAACGCTGCTGGATCTGTGGGCATATCGCAGAGTGAAAGAATTATTTAC
AAAAGGAGCTGAAGCCAGGGATCCGGAATTGTACAGGAAGTTGCATGACGAGAAATTGGTGATCTATTGTCATTTTCTAGGCACTGATTTGACAGGACCG
AAATATGGTGCCGATTCGAAAAAGTACTTGGAGAATATTGCTGTGGTGGATGATTTGATCGAGAAGACGTACAAGATGATCGAGGAGTATTATGGAAACG
ATGGACGAACAGCGTACGTCGTCAACGCGGACCATGGAATGGATCTTCGTGGCGACCACGGTGACGACGCTCCGGCCAAAACGAGGACGGCAATTATTGC
GTGGGGTGCCGGTGTCCTGGGACCTGAGACAGCGAAAAAGACTGACAAGCAAGATTTTGATATTGAGTTGCCCACTCGATCTAGAGTTGAATTGCAGACA
CGCCTGGGGGCACAGGCAAACGAGGAGGAGGTTGCTACCCGTGAGTGGAGTGCAGTGCTTGACTTCAAGCGCAAAGATGTTATGCAGACAGATGTGGCGG
CACTTATCAGTGCTTTGGCAGGACTGCCATATCCCCGCAATTCGGTTGGAGTTCTGCCGTTTACGTACTTGCCCAAGGACAAATATCGCGTAAATGCTAT
GCGTGCAAATGCACAGCAACTATACCACCATGCCTTACGCAAGGAGGAAGTGAAGCGCGCTCACCGGGGGATGTTATTTGTTCCATACTCACCTCTCCAC
CATCGGGTACCAGACCTTGAGGCTCATATTGACGAGGCCATCAATAGCCTACCTGAAGGTAAAAGCCACGCAATTCACGACGATGCGCACCGTGTCGTGG
AACTGTTGAGTCAGGAGATGATTGATATTTGTCGGAACGCGATCGATTATTACCATACGTACGACTGGTTGTTCTTGCGAGGATCGATCGTGCTGGGGTA
CATTGGTTGGGCACTAATCATGACGGTAGCTTATCTGCACCCTCAAAAATTCCGCTTACGGTGTCTGTTGACTCCTATGATTGACGTCAAGTTTGCTGCT
ACTGTAGCTGCAGTGATGTGGTGGCGGTTTCTCGCAGATTCGCCGTCGACGTATTATCTTTACGGATTCTGCCCTCTTGTCTTTTGGAAATTCGTTTGGA
GGCATCGTAATGACCTGCAAGCAGAACTCCCTTCTGTAAAGAGTTTCGGTTGGAAATGGAGTGTTCCAGCTGCGTTGGTTGTCTGTTGCCTGGAGCTGGT
TGTCGTTGGTTACAAGCATCGTGCCGCATTTAGCTTGCTATTTGTCCTGTTGGCATTGCAACTAAACGGAGACCTACAACAATCGAGAGGAAGCGTGCAA
CTGAAAGACCGTCTACACTATCGAAAATTGATGACACCACGTTTTTGTTGGTCTGCAAGCTGTCTTTTTATCGCCGTGTTCCCATGTCTGCCGACTGAGT
ATGGCGAAAACACATCGTTGGTCCATTTTGGAGCGTTGCTGTTATTGCTTTGTACTTTTATTGTGGTTAGCAATATATCTCCTATTCACGATCAAAGATC
CCAGTGGAAGTCGATGCTTTCTTCTGGGGAACCTCCAGTGCTATTGGCAATGCTGACTCTGCAATGGACCTCAGCCTACCTGGACAGTAAAGCTGCACCT
CCGCTTTTTATGGTGGCTTTAAACTGGATGCTTGTCATCGTACCAGTGACATGGTTACTCGTTCAAACAAAGTACCAAAGCCCAGGGGCTGAGCTATCCT
CGCTGAATTTTGAGAGTGAAGGCTATCTGGAGCGACAGCACACTGGTGAAGTCGCACACGTTGTGGTTGTGCGACTGATGAAAGTCATATTAGCGCTTGC
GCCAGGCTTCATATTGCTTAGCACATCCTATGAAGTGTTATTTTACGTGGCACTATGCAGCGGGCTTGTCAGCTGGATTGTGGTGGAAGCAAAACAGATA
TCTACTCGAGGGGTTTCTATGAGTCGTGAAGTGCGGCGAGCGCTGCTGCTGTTACTATTTGTCCAAGTTTCGTTTTTTGGTACTACCAACGTGGCGAGCC
TTACAAGCTTTCAGATTCCATCGACTCGACGGTTCCTAACAAAATCCACTCCCTCCATTGCGCAAGCGCTAGTCGTACTGAAGCTCCTGATACCGTTCGT
ACTTGTCGCCTGTGCTTTCCGTCTGATCTTACTGCTACCTTCGACAGTATCGACACAAGAAAAAGAGCTGCGCGGGAATTCTCTTTGGGTGTCGTCATAT
TTCCTTCTCGCAGTGGCTTTGGCGGACGTCCTCACCGTGCAGTTCCTGTTTCTTGTAAATAATGAAGGCAGCTGGAAGCAGATGGGGAATTCTATCGCCG
AGTTTTGCATCGTCAATAGCCAGATTGTCCTGTTGCCGACAATCAATTTTCTCGCTTGGGTTTTTGTTCACGACCTAGAAGCTACTGGCAGAGGATATGA
GCTAGTAGAAATAAATGAAGACGAGAAGGATCACTAGAAACTTCATGTAATCAACATTTTTTTTATTTTGTTGTCATGATACTGC