Transcript Name :
Phypa_INRA-310PPTG_13513
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8680.89419
InsideOutsideTMhelix
1-154
178-292
155-177
NN-scoreoddsWeighted Score
0.8295.1390.01
*** None ***
TypeScore
extracellular, including cell wall444
GO
*** None ***
*** None ***
*** None ***
Sequence
        879 bases(100 bases per row)
ATGGCTGCTTCAACATTTCTCTTAGCGCTGTTAGTTGTGTCCGGTGTTCGAGGCCAGTCAAGCTCATCTTCGTCCAGCTTGAAAGGAGCAGAAGTATCGG
TGGTGAATACTACAAACATCACCGACACCTGCAGCCAGGACGAGTACACCAGTGACTGCTGGTATCCTGTGGACTGCAAGATATGCCTCTCACGTACTGG
TTGTGCTGTCGAAGTCTCAACTGGTCGCTGCGTATCGAGCTCCAGTGCATTCGTAACTGAGTCTTCTTCGAGCGAGCTTTCTAATGCACCGTACTTCATC
AGCGGGGAGGTCAAGTACTGCAGCAAAATCGACCCAGCATGTTTCACGTGCCGCCGCGGCAACGCACCTGCAATTTGCTTGGGCTCCTCCGGTTGCGTTT
GTGTTTCCCAATGCGAGCACATCTCGACACAACCCACGAAATGCAAGCCTGGAGCCATCAGTAGCGTGAGCTACGGCGCCCTCATTGCAGCGGCGGCCGT
GCTGTTTCCGCTCGTCATGTACATGCTCGTCAAGGGCAGTAGTATTAGCCGCCTTCTGCGTCGAAAAGAGAAAACTCAACGCAATCTGCCCGGCCGCCTT
AAGCTCGATGCCTGGCGCAACCACCTCAACGAGCGCGCCGATCCTGTGAACGAGCGCTTTACCGATCTCGAGTTGCGCTCGTGCTTCGTACCCATGGAAA
GCGGCAGACGTCCGCACCTGCGGGCTGGGGACGACGCTGCAGAGACCGGCGATCACGTTGAAGCTGGTGACAGCGATGTCACGCGGGCCGTCGCTGTCAC
TGACATGCCATTCTCGCCGACTGAGGACCGCGCTAGAGAAGAGAAGATCGAGGATCAACCGGGAGCGGAACTAGTGTAG