Transcript Name :
Phypa_INRA-310PPTG_13471
Orientation:
(-)
Number of Exons:
21
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
GOLD8.699PS50866
RUN16.416PS50826
Zinc finger, FYVE-related10.511PS50178
Formin, FH2 domain37.567PS51444
HmmSmart predictionP-Valprediction_id
RUN7.1SM00593
FYVE zinc finger0.0023SM00064
Formin, FH2 domain8.3SM00498
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
RUNIPR004012
Zinc finger, FYVE-relatedIPR017455
Formin, FH2 domainIPR015425
*** None ***
InsideOutsideTMhelix
1-1561
*** None ***
*** None ***
TypeScore
nuclear652
GO
Biological ProcessGO IDPrediction Method
metal ion bindingGO:0046872IEA
integral component of membraneGO:0016021IEA
transportGO:0006810IEA
*** None ***
*** None ***
Sequence
        5690 bases(100 bases per row)
AGTGGAGAAAGGGAGGACAGTGTCAAATGCCTCCGACTGCTGCCTCGTTCCTTCTGCAAGCGGCTCCATGGGTCTCGTTGGATATTCGACGGGGAAGCGT
AGCAGACATAGCTCTACCCATTCCTTCTATTGCATTGCAGAAGAATGACGATCCGCAGGAGTGTTTGTTGTGGCAATTCCAGCTCCACGAGTACGATGTT
GGTTTTCAAGTGCTGGAAAATGGGGTAGTTGTGCAGGATTTAGGGCGGTTTAACGCGGCGAAGCAAGATGACAGTGACCCAAATACAAACGCAATGATGG
TGCCACATCCGCTGCAAGTTGAGCCTATGGAGTCGACGATGGAGGGCAGATTCGACAATATCAAACCAGAAAGCGTGTACACTTTGCGTTGGGACAATTC
CTACTCGTTAGTGCGCCATAAGCAGGTGCGGTATCGGTTCCTAATGACATCAAACCGTGTCGTTGCAGCTGCGGAGTTGGCAGTGCAAGAGTCGCAGTCG
CGTTCGCAGAGAAGAGCGAGAAGAGCGGCAGCTGGATTGCCACTTCCTCATTTAGCAAAGACATTGGAAAAGGAGCGTGCAATGAGTGACGAAGAAAGAA
AAGTGGGAAACGAAAGAATGACAGCGAATTTGGAGCAGGCGGTGATGGACATTGTGTCGATTTTCATTGCGAAACCTGACAGTCCACTGCATGAAGGAGC
CGTTCGGCCATTCATATTGGCGCTCGAAGCTGTTCTGTGCAATGGAATCAAGGTATGCCCACTATTTTTTTTCGTGTATGCATGTATGATGAGTGGCTCA
TTAATGTGTTAAAACGTAGGAAGAATTTCTGGATGTGTGGCCAGAGGCACCTTTCTACGAATTTTTACTGAAGACGCAACACGTGCTGCGCGACGACATG
GGCATCGTCGCCGAAGTACAAGCAGGAGAACCTCCGTCGAACTTGCAGTATCTGGGATGGAACAATTCTCGCTCCTTTTTACTGCTGACTTTAAACAAGG
GAATTCTACAGCGTGCATTCGAAGTACGTTTTGTGGATATGGATGTGGGTCATCAATTTGTCACACTTTTTCTAATGTTTCGATATGATAGAATTTGAGC
AAACGGAGAGTGGTTGTGGAGAAGTTCTATGAGCCAAAAGCCCTTTTGTACAAGTATGAGGACGCCCGAAAAATCGCTTCATTTCTCAGTGCGTTGAATG
GAGTCACTTTTTTGCTAGCTGCTTATCCTCCTGACGAGTGTAGCGACGAAGACCAATCCCAGTTTCCACGCAATCTCAAGCAATGCGCCCCAGAAGCCCC
ACTTCTTGGCAACGAACTAGCTTTTTATGATGACGTGCAAAGTGAAAGCAGTGTGATGAAGTTCATTGAAGGAGATCCTGACGAAATGAAGCAACTTGAC
AATTGCACCGTTCCTCGGTACATTCTTCACGGTGAACCATTTCAAGAAACTGTGATTGGGTACGTATTCGATACTCCTTAATCTAACTACACAATTGTTA
CCAATCTGTACCATCTTTTTTTCACTGTAATGCAGACGCTCTACATTTGAGCTGCTCTCAATCTCTGAGGTTTCGGGCGCCCCCGTTGTCTTAGCGCAGC
TACGCGTCCAAACGCAAGATATTTTGCTCTCCGTCGCTACTCAAGATGGTCAAGATCTGACTAAACCAATACGTTTATCAGCTTTGGACGAGTGGATTGA
ACTCATCGTGCGATTTAAGTCCAGTCCAATTGGAGGTCTGACACTGAAACTGGACAACTCGTACTCTATGGTTCGATCAAAACAAGTTCAGATTCGATAC
TTGTCCGCTGATACAGCCGCGTACGTAGCGGCATGGGAAGGGTGTTTGGAAATGGCTCAATCTATTTCGTGGAATCACGCTTCGCGGGCCGGAAGTGAAC
GCTGTGCCGAATACATGGCGTCATTGCATCAAAAAGAGGAGACGGAAGTGATACTTCAACGAAAACAAGTGAGAGGAGAAAGCAATCAAGACATGGATGA
TGGTATTATGGGGTTCCGCTCCTCGCTTCTCTCTAATCCTGTGTCATATATCGGAGGTTTACTATCAAGTGAAGGAAATCCTGAAGCCTGCGACCAGTGT
CTGACCCCGTTCTCATTCTTTAGCCGACAGCACGAATGCCCTTGTTGCAAGAAAATCGTGTGTATCCAGTGCTCTCGTCATCATGTTCAAGTCAACGGAA
AGGGTCAACAGTTGAAAGTCTGCGATGGATGTTTCATCAAAGAAAAAGAGAAAGAGGTGAGTACCTTGAGTCGATTACTGTTGAAGTGTGCAGTATGCGT
CTAACATTTATGGTTTTAGCGAGCACGTATTGCTAATATGAAGGGCAAAAGTGCTGGTGAAAGTGGTGAACGACCAGAGTACGCTGCGCTTCGCAGAGAC
CCTGCTATGGACAAGTATTTCAAGATGCTTAGCTTTGGTGTTCCATCCAGCGGAGTGGCCCAAAAAATGACTCAAGACGAAATGACTTCGGATAAAATTG
CAATATTTGTTGCAGGTCCTGAGGGAAGCACTGCTTCCGGTTTTGGTCGTACAACAAGGTGTGTAGGTATTCAGCGATAGAGTAAGTATGCACTGTACTG
ATATTGTTTTGTGTTGTGTCCATAGTAAAAGAGAACGATCGGGTAGTCGTGGTTTAAATCGACGTGACAGCACCTTTCGTAAGGTTTACTGGACTAATTT
GGACTCGGACAAGGCCAACGAAACTATCTGGTCTCGTGTGACCTCAAGGCGAAAGACTGCTCCGATCACACTATCGCCACAGGATTTTCAAGAACTGGAA
TATCTATTCGGAAACCGAACGGCAGCGTCACCTTCCCAGTCCAAGGTAACCAGTGCAAAAAAGACCAGATTCTCGGCTCTTGATTCACGAAGATCCAACA
ACATTTCAATTGGATTGAGCCAATTCAAGGCCGTTGGAGGGGCGGCGGCCATTTTGTCAGCATTAAAGAACTGTGATTTTGAATTCCTCACACTCGACCG
CTTGACGAATCTGCAAGACATCGCGCCGAACAGTGTTGAAGTGAAGCGTTACACCAACTTCAGAGGATCTCGTTCACGACTGGAACCTGCAGAAAAGTTC
CTGGTGGAAATGTGTGAGATTCCTCGAGTGACGGAAAAAGTACGACGCTGGTCTATGAATTTGAGCTTGTTGACTGACATGCTTGCTGTTTTGAATGCAG
ATTAATGTGATGTTCTTTGCTTCACAATTTCAACACCAGCAGCAAGAGTTGCGCAACCGGATTCGGGTGATTACCCAGGCCTGTTACGAAATCCTGCAGA
GCGAGCGCCTTGCCCGGTGCTTCGAATTGGTATTGGTGATTGGAAATCTTCTGAACACCGGCACAGAACTTGAAGGTGCTCACGGTATTACGCTTGCTTC
TCTTTTGAAGGTACGTTTGTCTAGCCTTGCCTTTGATCGTTCCAGCGTATGTTAATTGAATGCTCATATTGCTACCCTTAGCTGTCAGAGACCAAGGCTA
TAGACCAAAGTATGACCCTCCTCCAGTTCATCATCAAACTTATCCACGTAAGTGTCCCGCTGTTGGCTTCTTACTGATTCGTTGAACTAAGTATGTGTGA
TTTTGTCGTGTGTTAGAACCGCGGTGAAGGTGATGTTTTACTATTTACTAACGACCTTAGTACATTGATCGACGCGAGGAGATACTCTAACGTGATCTGC
GACTCTCAAGCACGATCATTGCAGCAGGAAATCACCAAGCTCGAGCAAGAGATTAAGGAAGACATGGTGGAGGATTTGAAGCGATTCAACAAAGCTGAGG
CGCTTAGAAAGCACCAATTTGAAGAGCGAAAGGTTCAGCGGCATCGCCCAGTGGTAATTCAGAGTAACAGAGTGCCCAATATTCCGCAAGAAGGAAAGTC
AGATCCTCAAAATGTCATCCTCGGCGCAATTCGACAGCGAGGCTCAAACACGGTGGTCGATTTTGGGGTTCAAACCGTGAATAATGGACTCACGTCGAAT
AATCCGCATGCTGCTATGCTATCTGCAATCCGTAGTCGTGGAGGAGCAATTGATACGAAGTCAACTGAGGAAAACTTATCAGCCAGAATAAGCGCGGGTG
AAAGGGGACATGCTAGCTTTGAGGTGGATCGGGATGCTATAATTTCGTCCGCAAGTTCACCTCATGCATCACTATTGAATGCCATTCGTAGTCGTCCACA
AAACGTACGAGATGAAACAAACTGGAACGAAGATAATTCAGTGCGCTTGAGTGAGGCAGTGCGAGCATCAAGCGCGAGATCGTCGCTCCTAGCTTCTATC
AGAAAGTGTGAACAACCAACGTTTAATCCAGATAGCAATCATCGCTCATCCATCAAGCAACGCCGTTCACGTGTGGCAGGTAACAGCGATGCCGGGGCAG
ATCAAAATGGTATATCCACTTTAAGCGGTGACTCACAAGCTGCACTGTTAGCAGCGATCAGGCAGCAGGCAACGAAACCAAAACAAGAAATGTCAGACAT
TGGTGGGGCTAGCTCCAGCAAAGCGAACGAGAAATTTGAACCACGTCAGTACAAGATGAAGAGCAAATTCATCTCAGTCATGAGAGAGCGACTGATGAAC
ATCAAAGCCGCATTTGAAGACATTGAGATGGATCTGGAGACATTACATTCCGTGTGGGACGGCACAGCTCGGTATTTGGCGGAAGACTCAAATGGATCGT
CGACCGAGTACGTATTCGGGCTGCTGAACAGGTTCCTTCTTGATGTCAAAGTCGCCAAGACGCTGCTTTTCCGAAAGGGGCTCAGTTTCGTTGGCGATGC
CAGCTCACTTCTTCCACACGCTTGTAAGTGAGCGTGTTGAGCTTTGTAGGTTTAGTGGCAATGTCTTTTAACGTGTAAGTGTTGTTGTTACAGACGTGGG
GAGCATCGTTGCGACTAAGTTCGGCTCCGGGGTAATCACGGCACTCCGAGTTACTGACAAGCGCATTGAGGTCAAATTTCCCTGGAGTCGAGAAGCATAT
CTGGAGCCTTCCTCCATTTTGTCTGTTGGTAGTTTGGTGCGTTGTCGTCGATGGGGTGTTGGGATTATCCGCGAGACTTGCTACGATGTGGGCTTCTGTG
AAGTTCGGTTTTCGTTTGGATACGGCAAAGTTCGTGTCGAGGATTTAGTGCTGGAAACTTCATCTAACAAAGAGGAGCTGCGTCTCAAGTTACTACGTTG
TGGTTTCTTCATCGGCGATCCTGTCGTCACGCCATTTGGATGTGGCCATGTCCAGTCAATTCGTGGGAAACCTCAAAGCTCCACTGCTGTGCTTTCAGTC
GGTTTGTTAGCATCGGAGCCTGATGTGTATGGTGGTGAACGAGTCTGTTCAGCGGTCGCGTTTGTGCCTGCAAGTCATGTTAAACGAAACTATTGAGATG
CAGCAGGCTATAGACTCTCGTCATTGGCACAAGAGAAATAGAGAAGTCGCGGTTACCATTTCACCGAGGAAATGACGTCTCGTTCTTTACCGGTGGTGAC
TCCAAAGTCACGAAAGTGAAATAGGCGTCCTAGAGATCCGCGTCTACCGCCGAGGCGCAGGCTTACATGATTATCTTTTGCACCACTACCTAGCGTCCAG
CACGTCCCCGTACTCATAGCGCACGATCTTGCTGTCGATGTAGTCGTTATGTTCCATGAAGAGACAAATGAAAGGCAATTTCACAAAAGT