Transcript Name :
Phypa_INRA-310PPTG_10795
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.4170.54224
InsideOutsideTMhelix
27-32
1-3
56-357
4-26
33-55
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1260 bases(100 bases per row)
AACGTCGTGAATGCCGTCAAGTCGCTTATTTACTATCTGCGTTACAAGCAGACCACGATCCCGACGACCGACACAGAGAAGCTGATGGACAAGGCCTTCC
AGTTGCAGATCGTCATTCTTGACTTGCCCCTGGCTATTTGCTCATGCCTCGGCATCAAGATCCCTCCCAAGCTTCAGTTCTCGGCCACCATTCTGGCTGT
CGTGTCGGCCATTGTCATGATGGCTGTCATGATCGGTGAGACCATTTTCGCTTCTTCGAACAACGTCATGCTCATGCTTCGTGAGTCGGGCGCTCTCAAC
ACTACTGCGCTTAACGGCGACACTATCGAGCTTGACACGTTCCTCAACACTAAAAACGGTACGTGTGGCTACGAGATGAGAACCCTCACGAACCGCGTCA
TGGGCAAGGTCTACGAAATCCGCAACAATACGCCCAATGCTGCTCAGAATGATGTGCGCGTCGAGGTGAGCAAGTCGCCCATCATTACTGATGACATCCC
TATTGTTACCAACCACTGCATGGGTGAGATCTGGACCAACAAGACGAGTGCGTCTTCGTACAAGACCCGTAACCTGCTGCGAAAGACGATCGGTGTGATT
GTTGACCAGCTGATTGAGGACGGCACGACTGACATGGGCAAGTCCGTGACCAAGAAGGAAAAAGCTCTCGAGTACTCGAACATGGGTCTCTTCATTCTCT
CCATTTTCGACCCTACGGGTATTGCCTGGATGGCTTCCGAATTCGTTCAGCCCATTTGTGGTCCCACCGAATACCTCGGAGAGATCGACGACGGCACTCT
GTACGACGCCCTGGGTTTGAACACTGTTGACCAGGCATTCCTGGGAAGCTACGGTGTCTGGAAGAAGAAGGGTGATGGCTCCGTCACGGTTTACTTCGAG
AGTGTTGACAAGTACGATGTGTCTGTGGTGATTAAGTCTGGTGGTGACAAGCTCAAGGAGGTCAAGGTGCCTGCTAACGGCAACGTCACGTGGACGTCTA
CGGTAGAGGAGCTGGGGGACAAGACATTGTACCTCGATCGCTGGCGCCCTGGTCTCTTCGGTCTGCCTGGTACGGGAGGTGGTTCCCTACTGCTGTGGAT
TCCGCGGTCGTCTGAGGGTGGCCAGCTTATTCTCCACGCGCGTTTGAATGTTAGCTAAGCGGATTCATCATGTCATTTAGCGTAGTGGGCATTTCTCAGA
AGATATGAGAAAAGTTTGTTCACATGTTTAAACGAATACATCAGATTATGTGGTCATGCG