Transcript Name :
Phypa_INRA-310PPTG_08712
Orientation:
(+)
Number of Exons:
5
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-85
161-251
312-396
109-137
275-288
416-778
86-108
138-160
252-274
289-311
397-415
NN-scoreoddsWeighted Score
0.6562.1660.004
*** None ***
TypeScore
endoplasmic reticulum478
GO
*** None ***
*** None ***
*** None ***
Sequence
        2668 bases(100 bases per row)
ATGGAGTCTTCCATGCCAAGAATCGAGAAGTCTACGAAGGAGACGCAGCCTGTGGATACAGGAGATCGAGATGTGTTTCCATCAGAAGGCGAAGGTGCCT
TGCGTCGAAAGTCTCTGCTGAACAAGGCGAACGGATCCCCAAACAAAGTATATCCCGGGCTAGAAGACAACACCCTCGAAAAGAAGTCGAGCAAGTACGT
GAAATCTGAGATGCAGTCCAATATCACACCAAGAGCACGTCAGAATGCAAACTACATAGTGTTACTTGGAATGGTTGCAGTGGTACTGACGTGTCTGTGC
TGGACGCTTTGGTTGATCCTGCTTAACGTTGCGCCGAACAACACGGTCAACCATATCATGGATACTTCAACTTTTGACTATGGTTCCTTTTGGTTAATGG
TTGACCCACCGATGTCACTGATGATTACAGCGACGCTTGGTCTCGTCTTGGTAGCTGTCGGCTACCTCGGTGTGTTTATCAAGCTAATTTCTTGTCGTCA
GGGCCCGAAACAAGCGTATTTGGTTCACCAGGTACCCGATTCAGCCGATTTTATGAAGACAATTGGAAAAGCTCTGGATGATGCGGCTACCAGACCTAAA
AGAGGAAAAACCACTTCTGCCATCGTAAAATTCGCTGCAGCACTTGCTCGAGAGGACAGCACAGAAAGGAAAATAAGTGTACGTGTTCTTACATCAGGAA
GTGCTATTTGCGAATCGCTTTGATTCACTTTCGTCCTGATTTTTAGAAACTACTGATGAAGTTTGGTGATCTGACTCTGGAGACTTTCCTACTTTATCAG
ATGCTCGAGTCTGGGTCCCCTGCTGTGCTTATTGCAGTTTTCACGGTCGTCGTGGCCTCCAACGCGCTAATCTGCGCTCTCATGATGTTCATTCCCTACG
ACCGAGCACCACGGGCAGAAACGTTTATTGACATTCTGTACGCACTGCATTATCATTTATTACCGTATTATACGTGTATTTTCTAACATTATTGTGTTCT
TTATGTTTATCTGGAGATTTGACTTTTTGATTGCCATCGCTTGTCCGATGCTTACGATTGTTTACTGCCTCTCCACTTTTACGTTTGATCGCGAGAAATT
TGCTATTAATCTTCAAGTGTTTCCAGCTGGATGGTTTGAGCAAAGTGCCAGCGTTGTAGCTGACCCCGTTCAGACCGCAGTGATCTACAAAAGTCTCAAA
TCATTACGAATCACGTCTACTTTGGATTTCTTTTCTCGCATGGGTATTAATGGAACTCTCTGCTTCAGACTTCGACATGTAGTAGAGCTCATCCATAACT
CCAAGAAACAGCAGAGCAGCGTGTACCCGAAACGCAGTCGCGTTGGTGCTGCTGGTCTCTTGGTTTTTACAGCGTTTCTGATAGTTTTCGTTGAAGAGAG
CATGCGGACGTCTTCGTTGGCATGTAAGCCACACCCTGAGTGTGTAGTGAATGCACGGCGGTGGATAATTGTGGGAAATGGATCACTGACACAATGTCCA
TGCCTCACAATGATCGACCGCGAGATCACTCCAAAGACGTACGCCGAGTGGGAGACACCGACGAATGTGACGGAGAAGTTGGCTAATCTAGCTGCAACGG
GAGATCTCCAGACTATTCAGATTACGAATCGCTACCTTGCCGAACTTCCAGGGCTACTACGACGCTGTAAAAATCTTAAACGCTTGTAAGTTCTTTTTCT
TATGTGATCCATGCGAAGCGGATACGTAACTTGTTTCTGCGACGAGTTTATCAGATCACTCGAGTACACGCATACACAAGAGCTACCTGAGTGGATTAAG
GAGTTCACCGAGCTAGAATATTTGTAAGTACCGAAATGCCAAGTGCCTGTGCATAATTACTGAATATTTTGCTGATATGTTTTTAGACATTTGGAAAGCA
AGTTTACCAGCCCAATGACAGTTCTACCTGATGATATGTTCGATGACATGACGTCCCTTACGTTCATGCACCTTGCAGCGTTCATGACAATGACTAAGCT
GCCGTCGTTTGGAGGACTCAAGAACCTCCGATCACTCACATTAGCGTGTTTCCTGTCTATGGTCGAGTTGCCAACATTTGACAGTCTCCAAAATCTAGAG
CGGTTAGTACTGGCATCCATGCCAGCGATGGACAGTCTTCCGGACCTTTCGGCTGTTACTGATCTCAAGTCGTTCGCAGTGTCGGATCGAGGTGCTTGGT
GCTGCAATGGATTTATTGGTACTTGTGATCTGGATGATCGTAAATGTGGAGTAGTGCACCCAGTATGGGGGAATCCCGCTGTGAGCTGCTTAGGGTCTGA
TCGGAATGAGAAAATAGCCACCGCTACAACACTTCAACTGGCCGGCAAGTTCTCGTCCACCATATGTGGACCTGTACTCGAAGCTGGAGTCCTTGAGGGC
CCACCGACTGAGAATCTTATGGCTCCATGCAACGGGACAATGTATCGACAATGTCCAAGAGCTGACAATGTCGAATCCATGTGCTACAACGCTCGGTTCA
TGGGGATTGCATGTACTACAAACCCGTACCCGATTGAAATGCGACGTCGTCAAATTGCCCAAGGAATTGGAGACTCATGTAATCCTCAAATTGAGGCGTG
GCTAGGCTGCAAGTAGATACATGCAACAACAATAACTCGCCTATTGTAAACACCCAAAATTATCTGGA