Transcript Name :
Phypa_INRA-310PPTG_00006
Orientation:
(+)
Number of Exons:
2
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Zinc finger, CCHC-type8.894PS50158
HmmSmart predictionP-Valprediction_id
Zinc finger, CCHC-type0.0066SM00343
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-213
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
nucleic acid bindingGO:0003676IEA
zinc ion bindingGO:0008270IEA
*** None ***
*** None ***
Sequence
        710 bases(100 bases per row)
ATGGAGATCGATGCTATCCAACACTACAATGGGCAACGTTCCATGCCGACATCGACGCGCCAGTCGCGCTCGCCGTCGCGTGGTCCCCGACCGATGAAAT
GCTTTCGCTGTAGCAAACCCGGTCATCGCGCAGCGGTGTGTCGTGCACCGGCGCCCGTGTTGGCGACTGTCTCCGTCGAGACTGACGTCGCCGCTCAAAA
AAACGGCGACAACCAGTAGGTGCAGGGCGCCCTACTGGCCGTGAACGGAGAGAGGGATCTCTGGTGGCGGATCCCCCTCCTAGCCCTCCAGTGCTTCACG
CACAACTTATTGTCACCACCTCCGGCAGCGACTCGAGGCTGATCGTGGTCAGTCTCCACGTCGAAGGCGCCCAGCGCCCGAAGCGTGCGATGGCCCTTCC
TGTGCAGCGTGTGAACGTGCAGCATGTGGACGTCCTGAGCATGATTCTCGGGGCGAACCCGACACGGCCGAGCAGGTACCACCGTGTCCGGATGAGCAGT
GGCTCTCGAGTAAACAAGACGTGGTTGAGCGTGGCCTCCCATGTGGTCGCAGCTGGGCTCCCGCGTGTGGTCGAGCGGGAGCTCCCTGGAAGATCCGATA
CGGTTGAGACGTGTATCCCGTATCTGGACGCCGAATCGGTTAATCGGCGTCACGATTCGACAGACATGATCGAGCATGGGCTCTCATCTCCTGTCTTGGC
AGACGAATAG