Transcript Name :
Phypa_INRA-310PPTG_00013
Orientation:
(-)
Number of Exons:
1
Description :
amino Acid/Auxin Permease (AAAP) family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-11
67-85
141-146
209-220
296-376
425-436
35-43
109-117
170-188
244-272
396-404
457-492
12-34
44-66
86-108
118-140
147-169
189-208
221-243
273-295
377-395
405-424
437-456
NN-scoreoddsWeighted Score
0.8173.8530.008
*** None ***
TypeScore
endoplasmic reticulum778
GO
*** None ***
*** None ***
Cluster Id
5
Sequence
        1843 bases(100 bases per row)
CGCTAGTTGGCCTACTCGTTGAGCTGGGGGCCGACAAGGCAAACCGCCCACCTCATTGAAGCTCAGTTCCCCATTTGCCGCCTTCCCCTCAAGTGACCGA
TACAACCGACTCCACAATGGCTCGCTCTGCAGTCTTCACGGTTGAAGACGCTAAAGCGGCCTTCAATCTCTTCTGCTGCGTTTACGGCATTGGAACGCTT
GGTATGCCCGGTAACTTTTCCCGTGCCGGCCCAGTGATCGCGGTCTTCGCCATGGCATTTATGGCCTTCGCCAACACGTATTCTTCGGTGGCTATCTGCC
GTGTCATGCTCATCGCTCCGCGTTCGGTCAAGACCTACGGTGATCTCGGTGAATGGTGCATGGGCAAAACTGGCCGCTACCTTTCTGTCGTCTCCCAGAT
GGGTAATTGTCTCTTGGTCCCTTGTGTGTTCCTGGTGCTTGGCGGTAGCCTTCTCGATGGTCTCTTCCCGGGGGCCTTCAGTGCCACGACGTGGATTATC
CTCATGGCTCTCGCTTGTCTGCCTGTGTGCTTGGTGCCGACTCTGAAGGAAGGAGCTGGTGCTGCCTTTGCTGGATGCATGGGTACGCTTGTTGCTGATG
TTATCGGTGTCGCCGTTGTGATGCACGGCATGCGTGGTCACCCGAGCGTGCCGACTCCTGATCTCAACTTCAAGCAAGTCGCTGGAGCATTCGGTAACTT
GGCTCTCGCCTACGGTGCTGGTATCGTGATTCCTGCCCTCCAGCGCCAACACAGTGACCCCACCCGGATGCCACGTGTGGTTGGCGTGACAATTGCTTTC
ATTTCGTGCTGTTTCCTGGTTCTTGCCAGTACTGCATACTCGTCTGTTGGGTGCCAGATCTCGGGTAACCTCCTGTGGTCGATCTACCCCGACTCAGACA
CTGGTCTGACCACGCTTGGCTTCGCGTCGGACTGGGGTATGGTCGTTCTCGCCTACCTCTTCATGCAACTGCACATTACGATCGCCTTCTCCGTCATCCT
GAACCCTGCATTCTACATCGCCGAGCGCATCGTGCTTGGAATGCACAAGCCTACCGTCGCTGATGTGGAGAACAATCTGCTTAGTTATGCCGATGCTGCT
ACTCCTGGTGATGGCGCAGAGCGCTCGGAGAAGGAGTCCCGTGCCTCCAAGCGCTCGTTTATCTCTGTTGCCGATAACGAGAACGTGCACCTTGGTGAAC
CGGAGGAGGAGGCCGCTGAGTACCGTGGGGTCAACACCATCAAATACGTAATTCTTCGTATCGTGATTATCATCATCTTGGTGATCGCATCAGTGCTTCT
AAAGGACCATTTTTCTGACCTAGCGGACTTTGTCGGAGCGTCGTGTATTACGGTGAATTCGATCCTTCTGCCGATTGTGTTCCTGTTGAAGAAGAAATGG
GACTCGCTTCCGATGTGGGAGAAGCTCCCAGCCCTGACAGTCGTTGTGGTGTGCTTCTGCCTGGGCTGCTACGTGACCTACACGTCGGGCAAGAATTTGT
TTGCTCCGAGCGACGATGATACGGCGTTCCCATTCTGCGCACCGGAATTCGAGAACACCGTTTACTATAACTACACAGCGGCTCACGAAAACTAATTGTT
GTCCTGGAGCTGCTTAGCTTCGCCTTTGAAGTTTTTTCTTCGAGAAGTTTGCATTGAACGAGCGCAATACCAACAATATTCAATACATCTGCCGTTCTGT
GCTACTTTGAGCTTCAAATCAGGGCAACTACAATTCATTTTCGTTACTGTAGTTTCATTTTTCCAGCACAAACGGATTTCATTAAAGTCGTCGCGCGACT
AAACAGCTCACTCATGGTTTTACCAGCTTAGGTTTCATGTTCG