Transcript Name :
Phypa_INRA-310PPTG_00016
Orientation:
(+)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-108
NN-scoreoddsWeighted Score
0.7263.9080.008
*** None ***
TypeScore
nuclear826
GO
*** None ***
*** None ***
*** None ***
Sequence
        327 bases(100 bases per row)
ATGGTCACACCAAGTTCAGCAAACCGTACACGACGTATGCAGACTGACAACAAGCGTTCGCGGGATGCCCGAAGTGGTGGACGGGCCTTCACAGGAGGTT
CGGGACGACGTCAAGCTGCTGCCGACGATTCATCAAGCGATGACGACGATTGGTTGGGCTACGAACTCGACGAACACCCTCAAGACGAGTTGACGCGCAA
GATAAAGGAGATTGTCGCGCTGAACGACTCCGACCCGACGCCGAGGATTGAAATGGCCTCGCACCGACTGTTGGATCGAATCAAGCCGTCCTCGGGAGCC
CACAACAATAGTGAAAACTCTATGTAG