Transcript Name :
Phypa_INRA-310PPTG_00742
Orientation:
(-)
Number of Exons:
6
Description :
hypothetical protein
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
Epidermal growth factor-like domain6.772PS50026
Epidermal growth factor-like domain10.938PS50026
HmmSmart predictionP-Valprediction_id
Epidermal growth factor-like domain34SM00181
Epidermal growth factor-like domain57SM00181
Epidermal growth factor-like domain22SM00181
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.8450.918
InsideOutsideTMhelix
1-796
NN-scoreoddsWeighted Score
0.8484.3450.009
*** None ***
TypeScore
endoplasmic reticulum444
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        3000 bases(100 bases per row)
AGAGCGACTGGGGCGCAGCGCACGACGATCGCAGCGTTGGCGCGCAACGCACAAGCGCTCGACGCCACATATTGGTTTATGAATGTCAATGGTGTTCTAG
AATATTTTATGATTTCCAGTTCAAACTAGAACTCTACTGTATCCATCTGGAAGTCATGAACAGCTGCGAAAGGAAACGCTGCCATTGACACAATGCTGAT
CTCACTGCTGCTTTGGGCGTTATGCGTGCAGGTTAGTGATGCGGCGATCACTTCGGCGTCTGTGATTCCGGTATCTCTGAATGGTGGCGTCACGGGAGCG
GTGGATGTGGCCTTCACGACAGGAACCACCATCCCGGTCGGCGGGACGATCGTCTTGACATTCCCCTCTGCTTTCTACGTGGACTCGGCGTCGACGTTGT
CCAACATTGTTGGCATAGATTCAACTAGTACGATAGTAGCATCACCCGCTACTGGCGTAGTGACTATCACGATTGCAACGACCAATGCTGCAGCTGGAGC
CATCTCCTTTACTCTTGATAGCATTTCGAATCCAGGTACGCTGCGTCCTGTCGGAATGAAATGCTGGGAAGGCTGACATGATAGCTCGCAGGTTTGGGCT
TGTCATCAAGCTACTTCATCCGCACTAAGAATGCTGGTGGCACAACCTTGGAGTCAGTAACGGTACCAGGCTCTACTTTCACTTCTTGGACTATGTCCAA
TGCTGCTACGGTGACAGCTCCTTCATTGCTTGCTGGTAGAACAACGTCCTACACGGCCACCTTGACAACCGATGTCACGTTACGCATTGGAAGTGTCATT
GCGCTGAAAGTACCTGTTCTCAGCGGCGGCGCGATCGTGTTCAGCAGCGCTACTCTTGCAGGCTTGGTGGGCATCGATCTAGCGTCAACGGAGCTGCGAG
TGTCATCACCGTATATTCTCCTCACAATTGCTGGTCAAGACATCGCTGCAGGACAAACTGTGTCGATCACCTACGGCAACATCATTAATGCTGCAGCACT
GTCCACACCACCGTTCTACGTTGATACGCGGCATCCCAATGGTGCCATTTTTCAAGTCAGTACTGCTACGAACACACTAACATTCACAAGCACAACGCTT
CCGTCAGCGACGATAACTCCTGTATCCTATTGGGCTGGTGTTACGACCGAATACAACGTGGTGTTTGCCAACTTGGCTTACGTGCCACCAGGAAGTCGAG
TGGAGGTAACATTTCCGTCCCGTTTTGACATTAGCAGCGCTACCCTGAGTCACATCACAAACTTGCCTATCGTGAATACTATTGTCTCTCTGGCCAGTTC
AACTATTGCAAGAGTGACGCTGGGAAATATTGCTGTATTACCTGGAACCGGACGTGGATTTAGGCTGCAAAACATCGTAAATCCTGGCTCCTCCTGCGAC
GAATTCATTGTCGAGTATTGCACTCCCACATGGGGATCGTACACAGTAACCATCACCGATAATGGTGGCAATGCCTTGGAAGCGTTGACGACAGTGGCAG
GTACACCGATTGTCAAGAAGCCGCTCACGTATGGTCGTGTTCGCCCGTTGCTCAAGACTCCCAACACACTTACAGTAGCGACTGTGACGCTCGACACCTC
GACAACAATTCCTCTTGGAGGTTATATCGAGGCTGTACTTCCTGCTGACTACAGTGTTGGGGCTGGGACGATTACAGCGAGTTCTTTGGTAAATATTCCC
GGCGCTAGTAGCGCTGTTATCTCTACACCAAGCTCCGTTAAACTACAGATTGCAGGCGCGAATATCCCAGCGACAAGCGGAATCTCGTTCACAGTCGACA
AGATTACCACGTCTTCAAATAATGCGGTTGGAAACTTTATTGTACGCACTCGAGACGCAGGAGGCAATACGATTGAAGAGAGCAGCACTGTAGGTGGCGA
AGGGTGTACCTATGTGAATGATTGCAGTGGTCATGGTACGTGTACGCTTCTCTCAAAGGTTTGTATTTGCAGCATTGGCTGGGGATCACCAACGGATGTA
GCAGAATACAAGTCACCAGACTGTTCTACTCGTGAGTATCCTACTGATTAACCATGTAGCAGATAGTCTAACTCATCGTCCATTGCAGGTGTATGTCCAT
CAAATTTCGCCTGGAATTCTATTCCCACAAGCACCACTACAGCTCATGACATTCTTGTCGAATGCTCCGGCATGGGGGTCTGCGATCGAGCTGCAGGGGC
TTGCAAATGCTTCCCCGGTTTTGAAGGCTCTGCATGCGAAAGGAGTACGCATCTTGGTGTGGAGAATTGTGTGTTAAATTGTGCTCACTGGTGGTTGTAT
GTGACAGTGAGTTGTCCGAACGACTGTTCTGACCGAGGAACGTGCATGAGTATGCGCAGCATGGCAGCAGCCAAGAACGCGTTGCCCATTTCTCCCCCAA
CAACCTACGGAGACAATCCGGTACGCCCGTTTTCAAACGGTAGCATCGGATTCACCAAGTAATTTGATCATTTGCTGGCAGTTCTCTGGTGCTTGGGACG
CCGACAGGATTTTCGGCTGTGTCTGCGACTCTGGTTGGGCTGTCGGGACGGCAAGCGGCGAGCTACAAGCCACAGAATACTTTGGGGCGGACTGCTCGAA
ACGTACGCTTAATCCTTGTCCAACGCATAGCAGTAGTAGTAACACGTTTAACTTCAATAGGTCACTGCCCCATTGGAAACGACCCCGACACGACTGCAGA
CGAAACCAACTGCCAGGGTAAGGCGGTACCAGGGGGCACCGCTGTAGGCGTCGCTGGGAATAAATGCCTTGTTGAGTGCTCCAACCGTGGGGGGTGCAAC
TACAAAACGGGCGTCTGCTCCTGTTATCAAGGGTACACTGGATATGCCTGCCAAACACGAGACGAGCTCGCCAAATAGCGTCAGTTAACCAAGATAGAGA
AGCATGGGATAAAAAGATCCGAGCAGTGGTTTCCGAGAGTCATTGCTGTCCAGCTTGCTGTGAATTTAAATAAGTGCAATGTCCTGCTCTTCTGCCTCCG