Transcript Name :
Phypa_INRA-310PPTG_00012
Orientation:
(+)
Number of Exons:
1
Description :
amino Acid/Auxin Permease (AAAP) family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-11
67-85
141-146
209-220
296-380
429-440
35-43
109-117
170-188
244-272
400-408
461-496
12-34
44-66
86-108
118-140
147-169
189-208
221-243
273-295
381-399
409-428
441-460
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
5
Sequence
        1599 bases(100 bases per row)
ATGCCGCGCAAAGCTTTCTTCACAACGGAGGACGCGAAGGCGGCTTTCAACCTCTTCTGTTGTGTCTACGGCATTGGAACGCTTGGTATGCCCGCCAACT
TCTCGCGTGCCGGCCCCTTCATCGCGGTCATTGCTATGGTTTTCATGGCCTTCGCCAACGTTTACGGCGCAGTGGCTATCTGCCGTGTCATGCTCCTTGC
ACCCACGTCTGTCAAGACGTACGGTGATCTCGGTGAATGGGCAATGGGCAAGACCGGCCGCTACCTTTCGGTCATCTCCCAGATGGCCAACTGTCTCCTG
GTTCCGTGTGTGTTCCTCGTGCTTGGTGGCACGCTCCTAGATGGTCTTTTCCCGGGGGCCTTCAGTGCCACGACGTGGATCATCCTCATGGCACTCTCCT
GCATGCCCGTTTGTTTAGTCCCCACTCTGAAAGAAGGAGCTGGCGCTGCTTTCGCCGGTTGTATGGGCACTATCATCACCGATGTTATCGGCGTCGCCGT
TGTGATGCACGGCATGCGTGGCCACCCCAGCATTCCCAAACCTGATCTCAACTTCAAGCAAGTTGCTGGAGCGTTTGGCAACTTGGCTCTCGCCTATGGT
GCCGGGATCGTTATTCCGGCCCTCCAGCGCCAACATAGTGATCCCACACGCATGCCCCGTGTTGTAGGAGTCACGATGACGTTCATCTCGGTTCTCTTCC
TTATCCTGGCCAGCACTGCTTACTCATCCATCGGCTGCCAGATCTCGGGCAACCTTCTGTACGCCATTTACCCGGACTCGGACACTGGCCTGACCACACT
CGGTTTTCGATCGGACTGGGGTATGGTCGTCCTTGCTTACCTCTTCATGCAGCTGCATATTACGATCGCCTTCTCCGTTATCCTGAACCCAGCTTTCTAT
ATCGCCGAACGTATCATGCTGGGAATGCACAAGCCAGCCGTCGCTGATGTCGAGAACAACCTGTTGAACTATGGGGACATGTCCACCCCGGTCGATATTG
CTGAGCGCTCGGAGAAGCAGTCGCACACTTCGCGCGCCTCAAAGCGTCGCTCCTTCATCTCTGTTGCTGACAACGAAAACGTACACTTTGGCGATCCGGA
GGCAGAGGCTGCTGAGTACCGCGGCGCGAACGCCATCAAATACGTCATTCTACGGCTTATCATGATCACGCTCTTGGTGATCGCATCGATCATCCTGAAG
GACCACTTTCACGATTTGGCCGACTTCGCGGGTGCCTCGTGTATCACGGTAAATTCGATCATCCTGCCCATTGTGTTCCTGCTGAAAAAGAAGTGGAACG
TCATGCCGCTATGGGAGAAGGCCCCAGCGCTTATCGTGGTCGTGGTGTGCTTCTCGCTGGGCTGCTACGTGACCTACACGTCGGGCAAGAATTTGTTTGC
TCCAAGCGACGATGATACGGCGTTCCCGTTCTGCGCATCGGAATTCGAGAACAACGTGTACTACAACTACACGGCCGAACATGAAACCTAAGCTGGTAAA
ACCATGAGTGAGCTGTTTAGTCGCGCGACGACTTTAATGAAATCCGTTTGTGCTGGAAAAATGAAACTACAGTAACGAAAATGAATTGTAGTTGCCCTG