Transcript Name :
Phypa_INRA-310PPTG_00017
Orientation:
(+)
Number of Exons:
1
Description :
amino Acid/Auxin Permease (AAAP) family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-19
72-91
144-149
210-224
308-399
451-461
40-48
115-123
173-186
248-284
419-427
482-514
20-39
49-71
92-114
124-143
150-172
187-209
225-247
285-307
400-418
428-450
462-481
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
5
Sequence
        1817 bases(100 bases per row)
CTCAAATTGGAGAAATGACTTGAGCCGTGTGCACCGCCTGAAAGGTGCTCTAACTCGTTCACTTTGGAATTTATCTTCTCTCGGAGAAGCCCAGCAAGCA
GCAGGACCCCGTCCAACCTTCGTATTTCGGCTTGTTCATTCCACGATGTCGTCCACCAACGGCAAGTCGGCTTTCTTCACCATGGAAGACGCCAAGGCGT
CTTTCAATCTCTTCTGCTGCGTCTGCGGTATCGGTTCACTGGCCATGCCTTCCAACTACGCCCGCGCCGGCCCGCTATTCGCGTCGGTTGCCTTAGCGTT
CATGATCTTCGCCAACACCTACGCAACTCTCAAGTTGTCCAAGGTGATGCTGGTGGCGCCGTCGTCCGTGAAGACGTACGGTGACCTGGGCGAGTGGGCT
CTGGGCAAGTGGGGCCGATTCTTCACGGTGGTTTCTCAGATGGGTGTGTGTCTGCTGGTGCCGTGCGCCTTCCTGGTGCTAGGCAGCACCCTGTTGGACG
TGCTATTCCCTGACTCGTTCAGCCAGATTTTCTGGATCATCTTCATGGCACTTATGGTCGTTCCGGTGTGTCTGATCCCGACGCTGAAGGAGAGTGCTGG
TATGGCGTTCGCCGGTTGCATGGGCACAGTCATTGCCGATATCATCGCTGTGTCTGTCCTGCAGTGGAACATGCGCGGCCACGGTTCGATCCCGTCGCCG
GACGTGACTCTGCACCAGGTTTTGACCTGCTTCGGTAATCTTGCTCTGGCGTACGGTGCTGCTATTGTGGTGCCCGACCTGCAGCGCGAGCACTCGCAGC
CACAGCGCATGCCGCGTGTGGTGGTCGTCACCATTCTCTTCATCTCTGCTTTCTTCGTCGCTGTCGCTCTTGCTGGTTACACGGCCGGCGGCTGCCAGCT
CTCCGGCAACATCCTGTACTCGATCGTGAGCACGTCGAACCCGCTTGGCTTGGCCCCTCTGGGCTTCACCGCCGACCGTGGTGCCGTGGTGATGGCCTAC
CTGTTCATGCAGGTGCACATTTCGATCGCTTTCTCGACGCTGATGATGCCTCCGTTCTTCATGGCTGAGCGTCTGGTTTTGGGCATGCACAAGGGCCCCG
AGATCGTCCGCTTCAACGGCGAGGCTGACCAGGCCAACGTGGACCTTGACATGGAGATCCAGGAGAAGCGTTCGTACATGCAGAGCTCAACCCCCATGGA
CACGGCTAACCGTCAGGTGTCTGCTTCGAGCCTGGTTGAGAAGACAGAGGGCCGTATGTCGCACCTGCGCGTCGCTCTGGAGTTCGGCGAGGAGATCACG
GAGGAGCAGCTTCACGCGCCCTACCGGAACAACCCTCTGCGCTACATTGCTCTACGTGTTTGCATCATTGCGATCCTGGTGATTATTGCCGTGCTTGCAC
GCAAGCGTTTCCTCGACCTGGAGGACTTTACAGGAGCTACTGCCCACACGACGAGCTGCTTGCTTTTGCCGCTGATCATCTACCTTCGTGTATTCTGGAA
GAGCATGTCGTTCCTGGACAAGGGCGCATCAATGCTGGTGATTGTGGTGTGCGCCATTACTGGCTGCTACGTAATGATCCACGCCGGCAAGGAGCTGTTC
ACCCCGTCGGACGACGACACATTATTCCCGTACTGCGAGACGGAATTCCAGGACGAGCCGTACTACATCCGCAACAACAGCACCAACTAAATCGTAACCA
GCCGCAGCAACTTATAAAGAAAGCTGTGCAGCTTTACGGTGTTGTATTGCATAGAGGGGTTCACTTTGTAGAGCAACAACAAATATAGTGTATCGTGTGG
TAAAATATCCTTGCTTG