Transcript Name :
Phypa_INRA-310PPTG_00015
Orientation:
(-)
Number of Exons:
1
Description :
amino Acid/Auxin Permease (AAAP) family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-11
54-84
140-145
206-217
293-371
419-430
30-33
108-116
169-182
241-269
390-398
451-486
12-29
34-53
85-107
117-139
146-168
183-205
218-240
270-292
372-389
399-418
431-450
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
5
Sequence
        1461 bases(100 bases per row)
ATGCCGTTCTTCACTTTCGAGGACGCCAAGACCTCTTTCAACCTCTTCTGCTGCATGTACGGCATCGGCACTTTGGGTATGCCAGGTAACTTCTCGCGCG
CCGGCCCCGTGCTCGCCGTCATTGCCATGGTCTTCATGGCCTTCGCAAACATCTACTCGTCCGTCAAGATGTCACAAGTCATTCTGCTCGCCCCCAAGTC
AGTCAAGACTTTCGGAGACTTGGGCGAGTGGAGCATGGGGAAGTTGGGACGCTGGCTCTGTGTCGTCTCTCAGATGGGATCATGTCTTCTTCTTCCATGC
GTCTTTCTGGTGCTTGGTGGCTCCCTCCTTGACGGCTTGTTTCCGGACGCCTTTAGCGCCACTGTGTGGATCATCCTCATGGCTCTCACGGTGTTGCCTG
TATGCCTTATCCCGACGCTCAAGGAAGGAGCTGGCGCCGCCTTTGCTGGCTGTATGGGCACCATTCTCGCCGACGTGATCGGCGTGGCTGTCGTCATGTA
TGGCATGCGCGGCCACCCTACTGTGCCCTCTCCTGATCTAAAAATCTCGCAAGTTCTAGGCTGCTTCGGCAATTTAGCACTGGCCTATGGAGCTGGTATT
GTCCTTCCAGATCTTCAACGTCAACACAGTGACCCCACACGCATGCCCCGTGTTGTGCTGGTGACGGTGAGCTTCATCTCATGCCTGTTCATGATTCTAG
CTTCTACAGCGTACTCGGCTGTGGGCTGCCAGATTTCGGGAAATCTGCTATTCACCATCTATCCAGATTCGACCACCGGAATGACCTCGTTGGGGTTTAA
GCCGAGCTGGGGCGCCGTGGTGCTGGCCTACTTGTTCATGCAGCTACACATCACGATCGCATTCTCTGTGATAATCAACCCGGCGTTTTATATCGCCGAG
CGTTTGGCTTTGGGTATGCACAAGAAGGTAACTATGGATATGGAAGTCGGTCGTAGTTACGTCGAGTCCATAACGCCAGCAATTGTCCAAACGGAGTCTC
GCCGCAGCTCAAAGATGTCCTATGTTTCCGTGGCCGACAGCGAGCGTGAATTTAAGGAGGACCCAGAGGCGGAGGTGGCAGAGTATCGTGGTGGAAAGAA
CATCGTTAAGTATATCGCGCTACGAGTCGTCATTATTGTCATTTTGGTGGTACTTTCGATCATTTTCCAAGACCACTTCTCGGACTTCGCCGATTTCGTG
GGGGCGTCGTGCATTACGATGAACTGCATTCTGCTCCCAATCGTGTTTTACCTTATGAAGGCCTGGAGATCCATTCCTCTTTACGAAAGGGCTGCTGCTC
TAATTGTAACCGTGGTGTGCTTCATTCTAGGGTGCTACGTGACGTACTCAACTGGCAAGAGTCTGTTTACCCCGACTGACGATGACACTGAGTTCCCCTA
CTGCGGTTCGGAGTATGAAAACCAGATTTACTACAATTACACGGCTGAACACGAGTCTTAG