Transcript Name :
Phypa_INRA-310PPTG_00005
Orientation:
(-)
Number of Exons:
1
Description :
amino Acid/Auxin Permease (AAAP) family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-20
73-92
150-153
212-226
310-384
433-444
41-49
116-129
177-188
250-286
404-412
465-500
21-40
50-72
93-115
130-149
154-176
189-211
227-249
287-309
385-403
413-432
445-464
NN-scoreoddsWeighted Score
0.7933.5550.007
*** None ***
TypeScore
endoplasmic reticulum778
GO
*** None ***
*** None ***
Cluster Id
5
Sequence
        1657 bases(100 bases per row)
GGCTCATTGTCCAATTTGCGGTCATACTGCCACCCACGATGTCTGCTCCTTCTTCGGCGGCGCGATCTGCTCTCTTTACCCTCGAGGATGCCAAGATCGC
TTTCAACATTTTCTGCTGCATCTGCGGTATCGGCTCACTCGGCATGCCGTCCAACTACGCTCGCGCCGGCTGGGGCTACGCGACCGTCGCGCTCCTGTTT
ATGGCCTTTTCAAACATATACAGCACCGTGTTGCTGTCCAAGGTATTGATGGTCGCACCGTCTTCGGTGAAGACGTACGGTGACCTCGGCGAGTGGGTCG
CCGGCAAGTGGGGTCGCTTTTTCGTGGTGGTCTCCCACATGGGCGTTTGCCTTCTTGCCCCATGCGCATTCCTCGTACTTGGCGGTACCCTGCTCGACGT
GCTTTTCCCCGATTCGTTCAGCCAGACCGCGTGGATCATCTTCATGGCTGTTATGGTCATCCCTGTGGCGCTGATCCCCACCCTGAAGGAGAGTGCTGGT
ATGGCTGTGGCTGGATGCCTGGGCACGATCATTGCTGATATCATCGGTGTTGCGATCCTCCTGTACGAGGAGCGCGGCCATCCTACACCCCCAACGCCTG
ACGTAACTCTGCACCAGGTTCTCACTACGTTCGGAAACCTGTCGCTCGCATATGCTGCAGCAATTGTGATCCCCGACCTTCAGCGTCAGCATTCACAGCC
CGAGCGTATGCCCCGCGTCATTATCGTTAGCCTGGGCCTTGCCTCGGCATTCTTCCTCGCCATTGCTATTATCGGCTACGTTGCTGGTGGATGTCAGCTC
TCCGGCAATCTGCTTTTTTCGATCGTGAACACGTCCGACCCCTACAGCACCACAACGCTGGGGTTTACAGCCAACCGCGGGGCGGTGGTTATGTCGTATC
TGTTCATGCAACTGCATTTGTCGATCGCCTTTTCAACAATTCTACACCCAGCGTTTTACATGGCGGAACGTCTCGTGTTGGGAATGCACAAGGTTGACCC
CCTGCGCACCGACAGCGAGGAGCGTGAGGTTGGGATCGAAGAGAAGATGTCATACCTCGCTGCGCCGTCCCCTGCGGCACCCGTCCCCGATCTCGAGAAC
AACAACCTTGAGCAGTGTTCGGCGCGTGAGTCGACGACAAAAGAGCAAGACGACCTCTCTGAGTACAAGGGAAGCGTGAACGTGGTCCGTTACGTCCTCG
TGCGTATCGCTCTGATAGCGATTCTGACTGTGGCCTCCATTCTACTGAAGGACCACTTTCTCGATTTGGTGGATTTCACTGGCGCAACCGCCATCACTGT
ATGCAGTTTGATTCTGCCGCTGGTATTCTATGTAAAGGTGTTCTGGAGGAAGATCCCGATGTGGGAGAAGGCGATCTGCATCACTATCGCCACTATCTGC
GGTGTCGTCGGTTGCTACGTCATGATTTACGCAGGAAAGAACCTGTTCAATCCGGACGACGACTCCGCCACGTTTCCGTACTGCTCAGCCGAGTACCAGG
ACGAACCTTACTACGTAAGGAATAGTACGGCTACTAACTAGTTTGCTAGAATATACCAACTTCCATATTTTCATTGTTCCAGTCAATGAATTCCGTCACT
GTCTACCACCAGGTTAATTGCGGGTGGGAACCTGTACCTGACGATAAATACATATAT