Transcript Name :
Phypa_INRA-310PPTG_00014
Orientation:
(-)
Number of Exons:
1
Description :
hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
33-94
211-222
361-366
1-14
115-187
246-337
387-623
15-32
95-114
188-210
223-245
338-360
367-386
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1925 bases(100 bases per row)
CGCAACTTCCTAAAACATGGGGGAAACGTCGCTCTTTCGTGTGGGGGACGACGTCGAGCTATGGCGTGTGTTGGTGCACCTGAGCGTATTGGTGGTTTGT
CTGTTATTGTTTGAGCGCATGCTGCACCGTTTGGAAGTCCATGCCGCCGTCTCCACCAAGTATCAGCAGCTGCTGAGCAAAGCGTATCGGGAACTAATGA
TACTCGGACTCATCGGACTCGGGCTCAAAGTGATCAAGGAAATATCTAGCGTCGACGGTAGCGGTGCTTCCATCACAGCCTTTCAGGTCGCAGACCTGAC
CATTTTCATCCTGGCGTTGGCACTTATCTTGCAGACCGTCTGCATCTTTCTCATACTGCGGAAGCACAATTTCCTAGCAGATCGAGCCGAACTCCTCCCA
ACAGAAGACTTGGCTGATATGTTACCTTCGTCAGCTTTGAGCCAAGAGACACAGGAGCTAGTTCAGCTGCGCTTGCTGCGTCATTTGTTCCTTAATCGAT
TCGAGCTGCCACAGCTCTTCCCATTTGCCAAGTATCTTCGACAGGCGCAAAATAACCAGATCACACACATGACCGATGTGGGTGCACCAATGTGGGCTTT
GCTACTTGGCGTGGCTTGGATGCTGGAGGGGATCACAATGGCCTTAAATTATGGGGAGCCAGCGCTGGCAAGGCGGCGTGGGCTTGTCATTGTGCTGATA
GGTTTTTCGTGGGGGCTGTTGGCGTTACATGTAGTTGTCTTCACTTTCTTCCGCTCATGTGTTGAACAACTACTGAAGGCTGTTGGAATGTCAGCAGAAC
AATCCACTTTAGAGAGCCGCCTCAGGTTCATCGCGCGCGAAGAAGCCCGAGCCTGGACTCAAGAGGATGCTGGGAATGCACTTTTGGTTATGCAAAAGGT
GCAAGAGCAGCGCGAATTAAGCCACCGCGAACAGCATCGTTCGAGCAACGGCAAATACAGCGTGAAGTCCGAGTCAGCTTCGCTGATAGAGATTCGGTGG
TTTTCACGGAAATCGTGGCACTTTACAGTGATGATGCTGTTGATGCTCAATGGTTTCTATCTTGCACTGATAGTACAGTGCGTGTTCTACCAGCTCGAGA
TTGTTTACGCTGACTTGGGACTTCTGGAGGTGCTGGCTATTCCACTTCCTTTAGCTCTAAATACTTTCCTTTTGCAACCGAAAATATTCCGGAGCTTTGT
CCTGGTTAGCAGCATTTTTAGTATGGATAGAACCACGTTGAGCGAGGTTGTTAATCACTTCCGCGAAATCGTAGAGCTGCGCTCTGAATTTGCACTCTTA
TTGTGCGTAAAAATGCAAGCGAACAGGGTATTAATTGATGATCTGCAAGCGGAACTAAAACGTCGAGATCCGAGCCGATCTGGTTTTATTGGCGTGGAGA
AGATGCGAGAAGTGTTGCGAGTCTGTGGTTTGCACCTGTCGAGGTTTAGATTCAACAGCGTTGCCAAACTTTTGTTCGAGCTGAAAGAAATGCGAATCGA
CTATGGTCAGCTGCTCAAGCTGGTTGCTATCGCTCAGAGTGAGGATCTAAGCGACAGTGCATCCTCTGAACAATTAATATTGATCCATCATCACCCGCTA
CTTTTGCAGAGTGTACTGAGTGACGACGACGAAGAGGTGGTCACCACGGATGATAACACTTATTCACCACCCCGTCCTGTACTAGCGACGTCGGCGCTCC
TTACTGCATCCATCCCCAGTAGCGAATGTGTCAATGAAAGCATAGCAGCTACATCTGACGTAAGCTCCCTATCTACACGACCTCAGTTGGAACGAAAAAG
AAGTAAGTTTCAAGGAATGAGCTCACGAACTCTTTGTGATCTCTTTCACCTGGAAAATACAGAAGATCAAGCCGTGACAATAACTTAACTAGATAAAAAC
GCTGCTGAGCAGTAGAAAATAAAAC