Transcript Name :
Phyag_g4652
Orientation:
(-)
Number of Exons:
6
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
SWIRM domain24.64PS50934
SANT domain9.624PS51293
HmmSmart predictionP-Valprediction_id
SANT/Myb domain1.7SM00717
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
SANT domainIPR017884
*** None ***
InsideOutsideTMhelix
1-1097
NN-scoreoddsWeighted Score
0.5481.2860.003
*** None ***
TypeScore
nuclear739
GO
Biological ProcessGO IDPrediction Method
chromatin bindingGO:0003682IEA
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        4647 bases(100 bases per row)
ATGGCGACTCCGCTCGactccagcgccgccacttCGACCGTCGcggcctcttcctctttGCCACCCACGTCATCTTCAGCGCTACCTTCTTCCGTACCCG
ACACTACCTCCGCGACTACTGTCAGCGTCCTAGAAGCCGCGCAATccgccgccaacgccgactCGGACCCTCTCACCGACCATGACGACTCCGAAGGCGC
CAAATCTGTCGCTGTGCCGCGATGCAGTACGTGGTTCGCCATGGACAAGATCAACCCCATTGAGAGACGCATGCTGCCCGAGTTTTTTGCTCAAAACGGG
TCTAAAACGGCCGAGATCTACCTCAAATACCGGAACTACATGGTGCAGGCCTATCGCCACCAACCAGGCGTGTATCTCACAGCCACAGCCTGTCGCCGCA
ACTTAGCGGGCGACGCTTGCGCTATACTGAGGGTGCACGAGTTCTTGACCCACTGGGGGCTCATTAACTTCCACGTGCCTCCGCACGCCATGCCTCCCTC
GATTCACTCTAATTACGCCCTAAAAACTGCTGGAAACAGTGGTAATAGGGACAATAAGGGTCCTGTAGCCATTCTTGTGGCTGCTAAAAAGGAGAACGCA
CGTCGGGTTGACGTTGCATTGGCCTGTGAAGGTTGTGGCACTGCTAGGGGGGCGGAAGATTCGTTCTTCGAGCTCACAAcggaagccaagaagaagctga
ccaGTAACGGAGCATCTACAAGTGTCGGCGGTGCGACGCCGTTGACGACGGGAGCTAATGGCAAAGCAGGAGAGGGGAAGGAAGTGACGATCGGAGGCTT
TGCGCTGAGACCGGGGAGTGGTATTTGTGAGGAGTGCTACATTCGCGGAGCTTTTCCTGAGGGATATGAAGCATCGGACTTTGTGCTGGTACCGATGGTA
GCGAAGAATCTTGCGGCAGCATCCAAGTGGACGCAGGAGGAGACagatttgctgctggaggctgtgagcagcacgagaaaTGGCGGGGTCAAGGGTGCAG
GAAacgaggacgatgagggTAGTTGCGACTGGAATTATGTCGCTTCGAAGGTTGGGACGAAGACGGCGGACGAGTGCTTACTCCACTTTTTGGAGATGCC
GATGTTGAATcagacgacgtcgagtcCAGGAAGTGGACTGGGGAACTCAATTCAGGAGCTGAGGCCATTtactgctggagaagcactGAATGCTCCTGTA
CTAGATTTGGTGGCGCTTGTGGAACAAGTGGACCCGATGGTGGCCAAGGCTGCGGCCCATGCGGCAGTTGGAGCTATCAAGAGGTTGCATACTATGCCAG
CAGGAAAGATTTCGGCGCAgaaatcagcagcagctactgaaGTTAAGAGCGCAGCAAGTGGGGATGGAGTCAAGGTTGAGGGCACGTCGGCTTCGACGGA
CCCCGATACCTCGCTCGAAggcgcagcggcggcagttGCTAGCAGTTCGGAGGCCGCAGGAATCGCGTCTACCATTAAATCTGAGGACGCGACCGCGGAC
GGTGATGTAACCATGGAGGAAGTGTCGCCGTCAACCGAGTCTGCGTCCAAGACTGAAGAAGATACGAAGGATGCTGCCACACCTATCTCGAAGGAAATGA
TTGCTGTcacagaagaagcagccaacgccactACCGTTGCATTATTGGCAACGCAGGCGCACAAGATCGCGGATGCTACTGCCAATGGCCCCGTTCGAGA
TCTTGTGAACCAATTGTTGGAGAACCAGTTGCGACAAATGGagttgaagatgcagcagctaaGTGTGCTGGAGCAAACAATCGTTGCTGAACGAGAGCAA
CTAGCCAAGGAGAAGTATCAGCTTTACGTGGACAGGCTAGCCTTCTCCCACGAGAAGATCAATGGTCGATCTGCATAGGTGGTGCCTTAGCGTTGTCAAC
ACCATGATTCTCGACGGGTTAAGAGCAGATGCGATAGCCATATTGAAGACCTCAAGGAAGTATCCGAACCACCGTTTGGTAATCCTGCCGAGTTTGAGTA
GTATTTCACATGCCGAGCAATGGCAGAAAAACTGCAGTGGTTTTGCAACGATGAGTTGTTGAGGTGCCGGTTGGAGGCCATTCATGGTATTGCTCAAAAA
TAATAGTCGTTGGTGTTTGCCAGGTTTCGTGGGAGTTTTTATAGCATTCTTGGGCAGGAGCGATGGAGGTTGCCGACGCTGGGGCAATTTCAATTGGATC
ACAGGAAGAAGCCATTCCAGTGGCAGTGACTACGGACGCCCCGGCATGCATTGTACGGACGAAGGTACGACCTCCTCAAGATTTTGTAAGTACTGTCAAG
CGTGCTAACGTCTTCTGTCAATTGAACTTTTACAGAGTGATCGCATTGTGCAAGACGCGTTGACGAACCCAGTCACCGATATCAAGAgtctggagctgcg
caactTTAGCCTTGATCAGTTGAGCAATGAGCAGCTGGACTCGCTGGTTGGTGGTTGCGGCCAGGAATGCCAAAGCTTGGTATTGGAGAAGTGTACGCTG
TCTGGGGATCGGTTTTTCGCCAAAGTGGCAGACCGATTAACGAGAAACCGAGTTAAGCTGGTGCATCTCCGCGTAAGGAGGTGAGTTAACGTCCACGCTT
GGTCAAGCTAGATGCTTACATTATTCTGCGTGTTCTGAACACCATAGCTGCCAGCAAGTGACCATGACATCGCTCATTGCCATGTCGACACTTTTCACCT
CGATGCTTGTCACATTGGAGTTATCGTCGTGCAAGCTTCCTCGGCAGGCTGGGATCATCTTAAGCCAGTCACTTCAAACCTGCACTTCCCTGCGCCATCT
TATACTGGCGGATAATAACATTCGTGACGGTGGCTTACGTGCTATTGCGGACGCATTGAAGCTGCTTAACATGTCGAGCGGTAAAGCTGTGGAAGTTGCT
ATCGGTCAGGAGGAATATTTATCCCGGCcaatgctggagcagttgaaCATTTCTCGCAATGGAATTACAGCGGCTGGATTCGCCTCCTtggtgcagcttc
cagtACGATGTTTGAGCGCACCAGGCAATGTAATCGAGGGTGGTGTAGGCGCGGTATTGCTTAGCAACGCTTCCACATTGGAGACACTTTGCCTGCTCGG
GAATCCGTTTTCGGAGGATGGTAAACTTGATCTTGTCCGCTCACTCTTCCGGCGCCGCGATAGAACAGGCAAGTGTGCTCTACGCGAGCTTGACCTGCGA
GCTTGCGGTTTTAACTCGGCGGAAAGTCTGGATTTGTTACAGCGCAGTTTtctccaagctgcaactgcaggTCAGCAATGTTCTTTGCAGACGCTTTATT
TGGATGACAATTCATCTCCtctggatgaagacgcaaaCGACAAAACAAACAAAGAAGGATGTGAATGCCTGAAAGAAGTTGCCAGGACACATTTCCCAGA
TCTTCGCCTAGATTTTCAATCAGACCCACACATCGACCACTTACCAGTTTCCGCGCGACTTGCTGGACGACCGACATCAGCTTGCGCGGTCCGCGATACG
AGTGATCAGGCGCCAAAGTCAAAAGCAACGGATCCTGCAAGTACACTACGATTGAGTTctgagctggaagctgtagCAGTGGCGACCAGGACCAGTGTGA
ATGCCACCTTAGCTTCCGTTGCTGGTCTGCCCACCTCTCCGTTACCAAGGCAAGTTGTACATGCTGAATATCCTCGTTCCAATGGTTCAGTCATTCTTCA
CTCGGTTGCGTCCGACACAGTGAGAAAGCCAACTGCGATCATTCAAGCGCACCCAGTACAGCCCAGCCTCACGATCTCTCCTACAATACGCCCAGATGCC
GTCGCACCGTTGCCGATGCAACACATTGACGTCGAGTTCATTGTCAGCAAGACCATCGAGTGTATGAGCCACAATTTTGAGCTACGGCTCGGACAATTCC
TCTCACGCATGGAGACTCAGCAACAGGAGCGGGTGCGTTAGTGGGGTAGTATTTTCTGATAGATATTCGCATAGACTAACTatacgctgctgcctttgtG
CACAGAACTCGTCGCAGGTGCAGTTTTTGGCGGCCAAAGTTGAAGCGTGTGAACGTGCCCTCCCGAGGCTGGATGCTCGGCTGGATATGCTCACAgatcg
agttgcagcaggcAGCGCTCAATTGGCCAAGTTGCAAACCGATGTagctctccagctccaacagaTTCGGCAGGAAGCACTCACGCACCAGATCTCAAAC
CCGTACAACTCGAATGCTTTCAACACTACGCAACTATCAACCACAACACCTCTTTCGTCTCGGATGCAGGCTCAAGTAGAAGAAACGGTGTCGAGTAGGG
TACAAGCTAGCGAGCAACGCTTCCACTCAGAAATGGATCGAGTCCGCGCTGCACAAGCGAATGCGACTCCTACAGACCCCCATGCCGTCGTGAACGCAGT
ATCAGCACACTTGACGCAATTCAAGCGCGAATTCGATTCCAACCAAGAAGGAGTACTGCAACAATTCACCGAGAGTGTTAGCTCAGACGGCCGCCGACTA
GAAGAACGCATCGCGCGAGTTGAAGCTCAGATTGGTAACCTCGAGTCTGTCATTCAATCGGAGCAGCAGGCCTCACTATTGGCTCTAGAGGCTATCTCGG
ACGCCTTTAACGACCCTGTTGCTTCTACTTCGAGAAGAATGGGGTGA