Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_3115-snap-gene-0.1
Orientation:
(-)
Number of Exons:
1
Description :
DEAD box helicase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-520
NN-scoreoddsWeighted Score
0.6492.0530.004
PositionContextScore
362RVGRTAR|GA0.568
495SRKRFQR|SG0.545
TypeScore
cytoplasmic391
GO
*** None ***
*** None ***
*** None ***
Sequence
        1560 bases(100 bases per row)
GCACTCGCGGAAGTAGCCAACCATGCTGCGCAAGAAGGGGGCGTTGATGAGCGATACTTTTCGAACGAAGAGTTCGCCTCTTTGCCTCTCTCTGAACCAA
CGAGAAAGGCGCTGGACGAGATGGGCTTTAAGAAAATGACCAAAATCCAGTCGAAATCGATCCGACCATTGCTCGCAGGACAGGATCTTCTCGGTGCTGC
AAAGACTGGTTCGGGAAAAACCCTGTCGTTCTTGATTCCCGCCATCGAGCTTCTCCACAAAGTGAAGTTCACACCTCGTAAGGGAACTGGATGCATTGTG
ATTTCGCCAACTCGTGAACTGGCGTTGCAGATTTACGGTGTTGTGCGCGAAATCTGCAAGTACCACTCGCAGACCCATGGCATTGTCATGGGTGGTGCGA
ATAGACGTGCGGAAGCAGAGCGTCTTGTGAAAGGTGTGAACATTTTGATTTCGACTCCAGGTCGTCTTTTGGATCACTTGCAGAACACGAAGGCGTTCAT
TTACCACAACCTGCAGATTCTCGTCATTGATGAAGCCGATCGTATCCTGTCTATCGGTTTCGAAGATGAAATGCGTCAGATCATCAAGTGCATTCCGAAG
GAGCGTCAAACGATGTTGTTTAGTGCCACACAGACGAAGAAGGTTGAAGATTTGGCGCGCTTGTCCATCAAGGAGAAGCCCGTGTACGTTGGTGTCGAAG
AAGAAGATGCGAAGGCCACAGTGGCCACGTTGGAACAAGGTTACGTGGTTACTCCAAGTGACAAGCGTTTCTTGCTTCTTTTTACGTTCTTGAAGAAAAA
CTTGAAGAAGAAAGTCATGGTTTTCTTTTCGTCCTGCGCCGCGGTCAAGTTTTATGGAGAGCTTCTCAACTACATTGACATTCCGGTGATGGACATCCAC
GGCAAACAGAAGCAAAACAAGCGTACGACGACGTTCTTCCAGTTCTGTAACGCGAAAACCGGTATCATGCTGTGTACGGATGTTGCCGCTCGTGGTCTCG
ATATTCCTGCTGTGGACTGGATCATTCAGTTTGATCCACCAGATGATCCAAAGGAATATATCCATCGTGTCGGTCGTACTGCTCGTGGTGCTAAGGGCAA
AGGTAAAGCCCTTTTGATGCTGTTGCCTGAGGAGTTGGGTTTCCTGAAGTATTTGAAGGCTGCCAAGGTCGCCTTGAACGAGTATGAGTTCCCATTGAAC
AAGATCGCAAACGTCGAATCCCAACTGATGAAGCTCGTGGAGAAGACGTACTATCTGCACAAGTCCGCCAAAGACGCGTACCGTGGCTACTTGCTTGCCT
ACGCTTCCCACGCTCTCAAGAATATTTTCGATGTGGGCAGCTTAGACTTGCAGGCCGTCGCGAAATCGTTTGGTCTTGTCGTTCCGCCGAAGGTGACGCT
GCCAGTCAAGACGAGTGGAAAGACGGGCAAACGAAAAGCTGGGGGCTTTGACGACGAAGGTAACTCGAGAAAGCGGTTCCAACGTTCGGGTCACGCCTTC
AGCTCGGATAATCCTTACGGGAAGCGCGCGGCAAACGACAAGCGCCAGTTTGCTCATTAA