Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1838-snap-gene-0.2
Orientation:
(-)
Number of Exons:
1
Description :
Gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-75
NN-scoreoddsWeighted Score
0.8474.1980.008
PositionContextScore
52RAAPKKR|KV0.641
TypeScore
mitochondrial609
GO
*** None ***
*** None ***
*** None ***
Sequence
        225 bases(100 bases per row)
ATGCATCGTCGCTGCTTCATTTCCAGTCGCCTACACACAAAGCACCGTCGGCTTCAGCGGCCGCCCACAAGTTTGCGTTCACCAGTGCAGGTGAGTACAC
GTCCCCGAAGAAAATTCCTGTCTTCCCCGGCACACAGAGCAGCCCCGAAAAAAAGAAAAGTGTCACCGGGCATCGGAGTCCCCGCCACACCAAACAGCAA
AATGCGTCAGTCCCATCACCGCTAA