Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1673-snap-gene-0.4
Orientation:
(+)
Number of Exons:
4
Description :
Pre-mRNA-splicing factor SF2
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        908 bases(100 bases per row)
ATGTCGCCGCACCCGCTGCCGCCCTCGCTCGCTATTGCTCTCCACGTGTGCACCAACCAACCAATGCCCGCCTTCTCTTCGTCTGCCCTCTGCTTCTCGT
CGTACTCTAGGATTTCGAAGACCCACGTGACGCCGATGATGCCATTCGCTCGATGGACGGACGCGATTTCCTCGGTGGACGGTAAGAAAGCGACAAAAAA
AATGTGTGCATGCATATCGCTCCTGGAACTGACATTTGCTATTTTGTGTGTGTGTCTTGCAGCATTCGTGTGGAACTAGCCCGTGGTGGCTCTCGCCGTG
ATGACCGTGGAGGCCGTGATGGTGGTCGTGATCGTGACGGTGGCCGTGGCGGCGATCGCTTCGAACGCAATGGTACGCTTTGCATATTCATTGGTAAAAA
GATGCGTAGATAGTGGTTGTTGACTGACTTTGTAATCGTTGTATACGTAGCTCGCACTCCTCCAACGCGCACGGAATTCCGTGTGCGTGTATCGGATCTT
CCTCGTGGAACGGACTGGCGCAACGTGAAGGACTTCCTCCGTTCGGGTGGTGAAGTGACCTACTGCAACATCGAGTCTGACGGCACTGCGTACGTAGACC
ATATTGTGATCCTTATGCCTGAATCAGTGTGTGAGCGAAGTCAACTAACTGTTTTTTTTTTATTTCTGCATCCGCTCTTGCTGATCAGTCTTGCTGAATT
CCAGTCCAAGGACGACATGGAGAACGCCATCAAGAAGTTGGATGATACTGAGTTCCGTGGCAACTACGTCCGCATCACTGCCGAGGGCTCGGACCGTCGC
TCGCGTTCCCGATCGCCACCTCGTGACCGCTCTCCTCGTCGCTCGCGCTCGCGCTCGGTGTCCCCAGCGGCCGCCCACTCGCCACCTCCACGCAAGAACT
CGGTCTAA