Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1328-snap-gene-0.10
Orientation:
(-)
Number of Exons:
6
Description :
Function: syntaxins are involved in intracellular vesicle trafficking
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-94
NN-scoreoddsWeighted Score
0.9085.7050.011
PositionContextScore
59EWSRVRR|AT0.714
TypeScore
nuclear696
GO
*** None ***
*** None ***
*** None ***
Sequence
        1271 bases(100 bases per row)
ATGAGCGCAGCGGCGTGGGCGAGCTGGTTGGACCGACTCGAGAATGCGCGCGGCCAGGAGACCATGATCGCCGCCAAGATCCGCGCCGGCAACGTCGCGG
CCATCGGCACGAGCGTGTTTGCGCTGCAACAGAGCACATCGCGGCTCAAGCGCGACTTTGAGCAACTCATGCGGTCGACGACGTCGAGTGTGTACGTTTT
GCAGACGCATGCGCTGCAGGCTGTATTACGTGGTGTTTTGTGTTGTGTTGCAAAATGGGTACTCATCGTGTCGTTTGCTTCCATTAATGTAGCACGAAGC
AGGAACTCGATCGGCGAGAGCGTTTATTGAGGCAATTGGATCAAGATCTGGTACGTTGGATATGAGTATGCGCGCTTGCATGGATATTGTGAGCACGCTG
GTGTTGATGGTTGCTTTATGGGTATTGCTATGATTGTAGAAAAACGATTTGGACTCGTACAACAGACGTAACAGTCCAGCCGCGAGGTATGCATGCGAGA
GGTCATATGCGTTTTTTTGTCAATCTTGTCTAATATATGTGTGTTTGTGTTCCTTACGTTTGTANNNNNNNNNNNNNNNNNNNNNNNCGAGAGCAGCCAC
GACAGCTGCTCAGTATGCAAAACCAGATTATGAAAGGTACGAGCCAATAAGCTTGACGTGCTGTGTGTGAACCCATGCAGCGCAAAATACTGACCTCATT
TGCTTTGTTATGCTGTGCAGATCAAGACCAGCAATTGGATCTGATTGGCCGCGGTGTGTCCAATTTGAAGAACTACAGTCTCACTGTGAAGGATGAAACG
GAGCTCCACGTGCGCTTGCTGAACGACATTGACGACGACGTGTCGCGCGCCACGAATGGTCTCGAGTCCGAAGGTGAACGCGCTGCAAAGGTACGAGGTG
CTTTGCTTATGGTTTTATTGATGATCTTCCCATGTGGCAATTGACGTTGCGTGTATTATTCATACATAGGTGGCGCGCCAGAGCAACAACTTCAAGCTCT
ATGTTATTATTATCATCCTGTTTGCCATTTTGATTTTCCTGTTGGTCGCGGGGAGTTAGAGCGTCTGGACAGTGGCTCGCAGTGCGGATAGTCAGTAGTT
CCTTTGATCCGAATGAAGCATAAAGCAACAGCAAGAAACGCCGAATCCAGACCAAGAAGCGTTATGTCCAAGCGTCGTGATAAAGACTACCAATGCCTAC
TCCATGTTGATGTTTATGTGAGGTCTTGGTGAGCTTGTATTGTCCCCAAAACTGTGCTATTGCAGCTCGTA