Transcript Name :
Albla_Nc14000220
Orientation:
(+)
Number of Exons:
5
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
Cluster Id
3605
Sequence
        1162 bases(100 bases per row)
ATGATCCGCCTTCCAATGCGACAACATGGGATAGGAAAGGCCATGTACCAAAGATATACCCATTCCATCACGTATTCGATGCGAGAGACTGTAAAAACGT
ACGATTATACAAACTACTTTTGTGGTCTTCTATTTCCACAAGATCATCGTGAGGCGTATTTCGCAATTGTACGTGATAATGTAATATGGCCGGTGACGAA
ACTGAAAAAATTACTTCATACTAAAGAGAGCATTCAACGTCGAAACAGCGAGGATTAGAGATATGGCACACGGAAAGCTTGCTCCTGGTACTATACGAAT
GCAATGGTGGCGTGAGAAGATTCAAAGTCTTTTCACCTCGCCTTCACGAAGCCCTTCATACGATTCTGTTCTTCTGAAAGAACTTGCCCATACGGTAAAT
GAAAAACAGTTGACAAGGTTATGGTTCGATCGTATCTTGGATGCTCGAGTAAGAAACTTCATACCTCGTAATATCACGACAGCGTTCCTCAGCGTGCATA
CATCAGGATAGAGATCTTGAAACCGAAGACTATCAAACTCTTGAACAACTAGTGCTTTATTCAGAGTACACCACCTCATCGCTTTTGTATCTGACATTGG
AATTATTGGGGGTTCGTGACGAGACGGCAGATCAAATCGCAAGCCATGCAGGTGTTGCAATAGGTCTATCGAATTTGTTACGAGCAGTACCATTTCATGT
TACTCAACAGCAAACATACATGCCCCAAGAGCTATTTTCCAAGGTCAAACTGTTCTTTATATTTTTTGAATATTGCCTTATCTTTGGTGTTAATTTCAGT
ACAATTTGGATGATGAAATGCTAGCACATGCATTGCAAAATCCGCTTCACGGGGAGGTGTTTGCACCTATCATTGAAGAGATTGTTTTAAAAATCCGAGA
ACATCTCGATATGGCCCGAGCCTTGCAATCCAAATTGCCCATTGTAGCACGACCCGCTTTTACCACGATCGTAAGTGGACTTGACCGTAGAAATCATACC
TCAACGCTCATGGCCTTTTTGCATTGATAGGCTGCCACGGAATCCTATCTACATCAGCTTCAGAATGCCAATTACAATGTCTTTGAGCAAAATTTGTTGC
AGTTCAGGCCCCTGAGCATACATTTCCGTATCATGAAAGCTCATTTTCTACGACGATTCTAA