Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1217-snap-gene-0.5
Orientation:
(+)
Number of Exons:
3
Description :
ATP-binding Cassette (ABC) superfamily
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
66-124
1-42
43-65
*** None ***
*** None ***
TypeScore
nuclear348
GO
*** None ***
*** None ***
*** None ***
Sequence
        2896 bases(100 bases per row)
ATGTTCGTGACTGAGTATACGTCGTATGTGCTGTTTTCGCTCACAGCCGAGCGCCAGATGAAAGTGCTGCGAGAGAAGGCTCTGCGCCACATGCTGCACC
TCGACATTGGCTGGTATGATAGCCACGACGCGATGCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNACTCGGCGATTCCTGCAAGTACACGTGCCAATTCATCGCCGGGTACGTCATCGGGTTCAGTAAATCGTGGGACATCAGT
CTGATCATGCTCTGCGCGATGCCGTTCATGGTGGCGCCGTTAGCGTATCTGCTGATCATGGTTCGGAAACGCTCCGAGCACTCGCAGCAGATCTACGCCG
AGGCCGGATCGGTCGCCGAAGAAACGCTGGGCTCAATCCGCACCGTCGCGTCGCTGAATNNNNNNNNNNNNNNAGCCGGAGCGATCGCCAAGTACAACGA
GAAGTCCTTTGTCGTGGAGCAAGACAACATCAAGATCGCCAAGTCGTACTCGACCGTGCATGGCTTGCTGTTTGCAGGTATGTGGGTCATGTTTTCGGCG
GGTCTATGGTACNNNNNNNNNNNNNNGCGGCTCGAAAGTTGTTCATCTCAAGAAAACGCCGGGTGAGGTGTTCCAGGCGTTTATTGGGATCTGGCTTGGT
ACCTACTCGATGGCGCTGATCTCACCGAGTATCACTGCCGTTGTCAGCGGGAAGGGTGCAGCGGGAGCGCTATACAAGATCCTCGACACGCCGTCAGCGA
TTGACGCCTCAAGCGAGGATGGATTCATCCCAAAATCGTGCGCTGGTCGTATCCAAGCTATCAATGTCAACTTTTCCTACCCAAGTCGCCCCGATGCCCA
GATCTTGATAAACTACAACGTGACCATCGAAAGTGGACAAACCGTGGCTTTCGTGGGGCCAAGTGGTGGTGGCAAAAGCACGCTGATCGCGTTGTTGGAA
CGATTCTACAACCCGACGAATGGTGTCATCCTACTGGATGGTCGTGATATCAGCTCGCTGAATGTCAAGTGGCTTCGTTCCCAGATCGGGTTGGTGTCAC
AAGAACCAGTGCTGTTTGCCACTACCATTTACGAGAATATCGCTGCTGGACGAGGCAATGTCACTCGTGACCAGGTCATTGAGGCCGCCAAGTTGGCGAA
TGCGCACACTTTCATCATGTCTTTGCCAGAAAACTACGACACCCTAGTTGGCGAGAAGGGCGTCTCACTGTCGGGAGGTCAGAAGCAGCGTGTTGCCATT
GCCCGTGCCATTGTTCGCGAACCCAAGATCTTGGTGCTAGATGAAGCCACGAGCGCCTTGGATGCGGAAAGCGAGCGTGTCGTCCAAGCAGCTCTCAACG
ATCTCATGGACAAGACCCAGATGACTACGTTGGTGATCGCGCATCGTTTGAGTACTGTGCGCCGCACAGACAAGATTGTAGTGTTATCGGATGGCACCGT
GGTCGAAGAAGGACCCCATGATGCTCTGCTTCAGATCGAGAACGGAATTTACCGCAACTTGTACACTCTCCAAGAAGAGAAGGCTCACGAAGAAGCCGAA
GCTGCAGCAGCGGAAATCAAGAGTTCGAGTCTCGAGGTTGTCGATGTGGCCAGGGATCGAAAAGCGAGTGTTCAATCCGTGCGAACTGATGGACACGGCG
AAGTCAAACCTACGAGCGACGACGAGAGCGAGGATTCCACTAAGAAACCCCAATTTTCCATGTTTGATACGCTGGCGTTCAGCAAACCGGAGCGGAAATA
CATGATTACTGGGCTTATCGCTGCTGCTTTCAATGGTTGCGGGTACCCAATGGCTGGTGTGCTCATGAGTGAAATGCTCGCGGTCATGACGGAGAAATAC
GCGATCTACGAGGTGTTCCACATCCAGTCATACTTGAGCGATCTCTCGCACGACGTCACATTCTACGGGCTGTGCTACATCGGAGGCGGCATCTTGTCGT
TTTTCTTCACTGCGATCCAGACGTACTGCTTCAAGTACATGGCCGAGAAACTGATTTACCGCCTGCGTGATATCCACTTTACAGCCCTTTGTCGCCAGAA
TATCGCATTCTTTGACGAAAAGGAGAACAGCACTGGTGCACTGACAGCAGATCTCTCGGCACACACCATCCAAGTCGCGCTTCTCTCAGGAGAGTCCCAG
GGCCAAGCAGCTCAGGCGTTTTTCACCTTTGTGGCTGCGATCGTGATCTCATTCACAACGGGGAGCTGGCAGCTCACGTTTATCATGCTCGGAATGTTCC
CGCTCTTGATGTTGGGCCAATACCTCCAGGCCGGTGAACTCTTCCACGCAAATGATCTACCTGCCGATCTGGCTCAAGTTGGTGCACGTGCGTCCGAGGC
ACTCAGTAATATTCGCACGGTGGCGTCCCTTGGTCTGGAGGGCTCTGTCTTGGACAAATTTGCGATTTCTCTGAAGATTCCTATGAAACGCGAGCGACGC
AAGTCCCACACAAGTGGAATGTCGCTGGGTTTTGCATCGTTTGTCTTGTTTGCGACGTACTCGCTCGTGTTTTGGTATGGCGGGTACCTCGTTGACCACG
GCAAAATTACGTTCAAGCAGTTGTCGCGCACGTTGTTGACGATCATGATGTCAAACGTTGGAATCGGCCTCGCCGTCTCCTTTTTCAACGAGACCCAGAA
CGCGACGAAAGCTGGCGCTGCTCTGGTGGGTATTCGCGACAGAGAGCTGCCGATTGACTCGTTTGGAGAAGGAGGGCTCAAGCCATCGAAGGTGGTAGGA
AAGCTCGAGTTCAAGAACGTTGCATTCCGGTATCCGACTCGTCCAGATGTTGTAGTTCTCAAGAACTACAATTTGACTATCGAGCCCGGTCAAACG