Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1119-snap-gene-0.4
Orientation:
(-)
Number of Exons:
6
Description :
Cysteine protease family C01A
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5910.57221
InsideOutsideTMhelix
1-397
NN-scoreoddsWeighted Score
0.6491.440.003
*** None ***
TypeScore
nuclear652
GO
*** None ***
*** None ***
*** None ***
Sequence
        2459 bases(100 bases per row)
ATGTACCCACTCACGATCGTCGCTGCATCGGCCCTCATGGCAAGCGCAAACGTGCACGCGCGCCCCATGCACGCGGCCATCGAGCCGCACTACCACCGCT
ACCTCGAGGAGCGCGCCGACATGCAAGTCGAGTATGAGGCGTGGATGAACAAGTTCAAGGACAGCGCAAGCGCGAACAGGTGGATCCCCGTGAGTGAAGC
CCGCAGTGCTGACGAAGAGCAGGAAGACCACCTGCAGCGCTTCTTCCTCACCAAGCAAAAGATCAAGGAGATGGAGTTGGAGAACCCGGACGCGCAATTC
TCGACCGATTCGCCGTTCACGCTGCTCACGGACGACGAGTTCAATGCGTATGTCGGTAATGCCTACCGCAAGGGAGAGCAGGAAGCGACTCGTCGTCTTC
GAAGCTCATACGAGTACGCGGACTATGATCACCGGGGCAACTGGGACCAGGCNNNNNNNNNNNNNNNNNNNNNNNNNNGACGACAATGGGGTCCGGCGTC
TTCGTGGTGCGTACGATTGGAGCTATGAGTACAATTGGACTTCAGACGATGGGTACGANNNNNNNNNNCACCGGCGACTACGAACTCCAAGACAAACAGC
AAGAGCAACGGATGGAGCTACTCGTACAGCTGGACGACGGATGGAAACGGCAACAGGAAGGCGAAGGACTTCCAGTGGTCTGGCAGCAAACCAGCGAACT
GGGGAGACTGGATGAGCTGGTGGAACAAGTGGAAGAGCGGAGGNNNNNNNNNNCGTCGAATGTGGACAGGAGGGAGCCGTTTGAGACAGATTATGCCAGC
TCGGAAAATGAAATCACTGGTAGCGAAGGAGACGCCCCGTTGGATGATAGCAACCTGCCTGTGGCTCCAGAAGGCGATAACACTGTCGACAAGGGGGCAG
ATGGAAGAAAGAAGCTACCAGTCTCTCCAGAAGGTGATGGTGACACGGACGATACCAATGGTAATGACGCTGACTTGGACACCCAAGGACCATACGGGAT
CATCGACTGGGCGAAAAGCCAGTGCATGTCGCCCATCCAAAATCAGGGCCAGTGTGGCTCCTGCTGGGCATTTGCCAGTATCGCAGCCGTGGAATCTATG
GAATGCATCCTCGGCGATCGGAAGACGCTANNNNNNNNNNAGCAACAACAATGGCAACAACAACCAGCCATCGGGAGGTTCCAGCAACAACGAACCTCCT
GCAACGGTTGCTCCATACAATCCTGCGCCTTCGGCTCCTGCGACTTCGGCTCCTGCGACTTCGGCCCCAGAGACTTCGGCCCCAGAGACTTCGGCCCCAG
AGACTGCAGCACCAGAGACGGCAGCACCTGAGACGTCTGCTCCATCCGACGGAGACAACAACTTGCCCGTTGCACCAGAGTATCCAGATGAGACAGAGGC
TCCAGCGGCCACTCCTTCTCCTCTGACGATGGCTCCGCAGACTGATGCCCCTGCTTCCTCGGACGATACCACTGGTTATGACTTTGACACTGCCACGGAG
GCTCCAGTCGCTGCCGAGGCGTCCACGCAAGGATCCTCCGGCTACATTGACTGGACGACAAGTCCATGCATGTCTCCAATTCAGAACCAAGGTCAGTGCG
GTTCGTGCTGGGCGTTTGCCAGTATCGCAGCTGTGGAATCCGCTCAGTGTATCGCTGGTGGCCAAAAGTCGCAGCCAAAGTACTCGGAGCAGCAACTCAC
GAGTTGTAACACCAGGAATGACGGCTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGTTCCAGTACATCCAACAGAACGGTCT
GTGCACGGAGCAAGCATACCCATACACTTTGAGCAACGGCGGCAGTGCGCAGTGCAGTGCCAACTGCCAAAAGACTGATCCTGGTGTGAAGGGGTCCACC
CGAGTCACGGGCGAAGACGGTCTCTTGAGTGCCTTGGCGCAGCACCCTGTCGTGGTCGCGGTCGCTGCCGGCAACAACGCGTGGAAGCAATACCAAGGCG
GTGTTCTCTCTGCGTGTGACANNNNNNNNNNCGTTCCAGTACATCCAACAGAATGGTCTGTGCACACAGCGAGCGTACCCATACACGTCGAGCAACAACC
GCAACTCGGAATGCAACATCAACAACTGCGAGCGAAGCTACCCTGTGGTCACGGGTACCGTTAGTGTCTCGGGGGAGAACGGACTTGTGCGTATCTTGAA
GCAACACCCTGTCGTGGTCGCGGTGGCTGCAGGCAACAGCGCGTGGAAGCAGTACGAGGGCGGCGTTTTGTCCTCGTGTGAGACGAGCAAGATCGACCAC
ATTGTGCTCGCGGTCGGGTACGATGAGAGCACGATCAAGATCCGCAACTCGTGGGGCACGCGCTGGGGAGAGAGCGGCTACATTCGCTTGCGCCGCGGCA
TTTCAGGCGACGGTGCGTGCAGTGTGCTCTCGGATATCTCGTACCCAGAGATGAAGTAG