Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_990-snap-gene-0.7
Orientation:
(+)
Number of Exons:
4
Description :
Replication factor C subunit 4
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-134
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1132 bases(100 bases per row)
ATGTTCTCCGCCCGTCCGACCAAGACCAACGCCGTCCCGACGGTGCTGCCTTGGGTCGAGAAGTAGTACGTGAATGTGTCAGTCTCCTGCAGCCAAATGA
ATGTCGTGGCGTGAGTGTCTAACGAGCGTGTGGATTGTGGATTATGTAGCCGTCCAAAGAACGTGGACGAGATTTCTCACCAGGAGCACGTCGTCGCGAC
GCTGAGGACGTCGATCGCGAGCGGTCAGTTGCCGCATTTGCTGTTCTACGGACCGCCCGGCACGGGCAAGACGTCGACGATTGTCGCTGTGGCGCGGCAA
CTGTTTGGTCCGGATTTCCGCAAGAACGGGCGCTTTCTGGAGCTCAATGCGTCGGATGACCGTGGCATCAGCGTCGTGCGTGAAAAGGTGAAGGGGTTCG
CGCAGGGCGCTATCAGTGGTTCAAGCACGATGCCGCCGTTCAAGATCATCGTGCTGGACGAAGCAGATTCGATGACTGGCGACGCACAGTCGGCGCTGCG
CCGCATGANNNNNNNNNNNNNNNNNNNNNNGAGAACTACTCGAAGGTCACGCGCTTCTGTCTCATCTGTAACTACGTGAGTCGTATCATCGAGCCCGTGG
CGTCGCGTTGTGCGAAATTCCGTTTTGCGCCGCTCGAGAAAATGTCCATGACGGCGCGCATCCAGTACATTTGCCAAGAGGAGCACGTCGAGTCGAGTGA
CGAAGTGATCGANNNNNNNNNNNNNNNNNNNTCGAGTGCTCGAATGGCGACTTGCGTAAAGCCATCAATTTCTTGCAGAGCGCAAAGCAGTTGTGCGGCG
ATGAACCGCTTTCCAAGGACGACGTCATTGCTGTGGCTGGTCTGGCGCCTCCTGAGCTCCTGGAGCTTTTCTGGAAATCCGTGGCATCCAACAGCTTTGA
CAAGATGAAAGTCGAGATTGAAAACATCCTCATGGCCGGGTACCCAGTGCTCACGGTGCTAAAGCAGCTAAGTGACGACGTGCTCACGAATGCCAAGCTC
AGCGACACAAAGAAGGCGAAGTTGTGTCTGCGGATCGCCGAGGCCGACAAGAAGCTTGTCGACGGCGCAAGTGAACACTTCCAGCTCCTGGACGTCGCGT
CGTATATCATGCGCGTCTACCACTCGTCGTGA