Transcript Name :
Albla_Nc14000240
Orientation:
(-)
Number of Exons:
4
Description :
conserved hypothetical protein
This protein is a Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
GOLD8.607PS50866
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.5510.73118
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
integral component of membraneGO:0016021IEA
transportGO:0006810IEA
*** None ***
Cluster Id
2117
Sequence
        1243 bases(100 bases per row)
ATGTGGTTCTGCGTCACATTACTTGTTGTCGGCCTTCACGTGACTTCGTCCTCTAGAATTGCATTCCAAGTGTCAGCAAATAATCATGTAATTAAATTCA
ACGCAATGATCCTCTCATTCCTCTCGTAACGCTTCTCCCCAACGTAGGAGTGTTTTTATGAAGAAAACGCGGCACGTGCGTCTACAACGTTAATGACAAT
GCGTTTTGGTGTATTGAAAGGCTCCAAGAATGATAAATTAGCTGTAGCAATACATAGTCCATCTGGCAGAATCTTAAGTAACTGGACGGATACTCAAGCT
GAACATACTACATCTCAACTACACGAATTTGGAATGTATTCAATTTGCTATCGACGATTAGGTGGATCGTACAAGATCAATGTGTTCCATACTGTGGAAT
TGATACCATCCGGGATAGGCGTGTTTCTCCTATATCCCGCTACAACTGCGACATTGCAGAAGCGGAATCCTGCAGCAGCAGATTATGGAATATTTCAAGC
TTCAGATGATGAGAAAGGCCTGCAATTTGGTATCGTAGATTTTAATCTTGAATCTCTATCACCCAGCATGATAAACGATAGAAGTCGAGCTTTTCTCTCG
CTTTCTATCCGGTACAATTCGACTTCGGATGTACGACTTCAGGTCGCGCATATGACCGACTCGGTGCAATACCCGTTGGAATGGTCGCAATTTAAGTCGC
ATATAGAGAATCTATCGCAACGTGAGATTGATGAAGATCACGCTACTAGTGGAAGCCATACGTCTTTCGACATCACCGAATATATCGAGCATGCAATGAA
AGAAGGCAAAAATGCTATTACTCTCACAGTAAGTAAATGCCTGTCTGCATGAGATAGTCTCATCTTAAACACCTGAGTAGATTCATGCAAAAGGAGGATC
TATTGCAATCGATGGCATGAGCCACACTCCAGCGTCGCTGTACCCACGAATATTAATTGAAGAAGAGGAGATTCATTCGCTTTTGCACATCAAATATCTC
AAAACTCGCATCCTCGACCTACGAGGTGAAATCTCCTACATCATACAAAGAGAAGAGCATAGTCGTGATGGTAAGGAGATCCTTGCTGACATTCGCACAT
TGATACAAATATATTTCTATGTAGCTGCGGAAAGCACCAACTCGCGCGTCAAGTGGTTTTCATTGATTATCAACGCTTTCTTGATGTGTATCGCAATAAT
CCAGGTCCTATATGTCCGAAAAATATTAGAGGGAGGGTACTAG