Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_604-snap-gene-0.8
Orientation:
(+)
Number of Exons:
5
Description :
EF hand family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-385
*** None ***
PositionContextScore
286GLSRKFR|LM0.507
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2579 bases(100 bases per row)
ATGTTTGCAGCCGCCAAGCAGAGTAAGGAACTGCGCCGCATCATCGCGCATCTTCGCGCCGCGCTCAAGGACCAGGGCGCCGTCGGGTTCATCTCGCTGC
AACGCAAGTTCCGGCTCATGGACGACGACCAGAACGGCAGCATCAGCGTCACCGAGTTCCACAAGGCGCTCCACGAGACCAAAGTGCACCTTGCGCCTGC
AGATGCGACGACCTTGTTCCAGTACTTTGACGCGAACCATGACGGCGCCGTGGACTTCCACGAGTTTCTCGCAGGCATCCGCGAGCCCATGAGCGAGCGC
CGGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGATATCCTGGACACCGACAGCAACGGCGTGCTCGAGGTCAGTGACATTGTCGACATCTATGACGC
GCGCAAGCACCCGGACGTACTCTCGGGTCGCAAAACTGAGCACGACGTGTTCGCCGAGTTTCTCGACACGTTTGGCGACGTCGACCACGACGGCAAGATC
ACCTTCGACGAGTGGATGCGGTACTACGCCAACATCAGTGCAAGTATCGACGATGACGACTACTTTGAGCTCATGATGCGCAACGCGTGGCATATCAGTG
GCGGCCACGGGTGGTGCGCCAACTCAGCCAACCGCAGGGTGCTCGTAAATCATGCCGACGGCCGTGCCACAGTTGAAGAAGTCCAGAACGCTACGTCCCG
AGGGCCCACAGGTCAGCGTACGAGTGCTTCATTCTGCGATATTCTGGACTACAGCAGCTCAACAGCAAAGTCGGCGCCATCGCGTCGTGTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCGACTCGCTCGCTGCGTGTCTGACCATGGCATCTACGAGCAAGCCGCCATCAGCAA
CAGCAGCAGCAGTGCCTGGAACCACAAAAGTCGCAGTCGTAGCGCAAGATACGCCGCAGCGTGACCACCCCGTCGGCGTGCAGCTCATCATTGCAAAGCT
GAAAAACGGCCTCAAGGCAAAAGGCGCGCACGGATTCTGCGGTCTCAGCCGCAAGTTTCGACTCATGGACGATGACGGCAACGGGTCGCTGAATGTGACC
GAGTTCCGCAAGGCCATGAAGGACATGGAGCTCCAGGATCTCACGGACGCCGACTTGAGACTGCTCTTCCAGTACTTTGACCGCGACCGCAGCGGCAGCA
TTGATTTGAACGAGTTCCTCGTCGGTGTGCGCGATCCGCTGAACGAGCGCCGCGTGTTGTTTGTGCGAGAGGCGTTCAAGCGCATGGACAAGGACGGCAA
CGGTCTTCTCGAGCCAAGCGACATCGTCGAGGCGTACGATGCCAGCAAGCACCCAGATGTGCTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAACGGCAAAATCACATGGACACAGTGGCTCCACTACTACGAGAACATCA
GCGCGAGCATCGACGACGACGACTACTTCGAGCTCATGATGCGCAACGCGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACCAACCGCCGAGTGCTCGT
GACACTGGCTGACGGCACCGACATCGTCAAGGAAGTGCAAAACGATCTTGGCGTGCCGATCCAGGATGTCCAGTCGAGACTGCGCACTCAGGACGATCGC
GTAGATGCCAAAAGCATCGCAACTGCCACATCCATCAACACCACGCAGCCTGCTACTGCTTCGAAGCCAGCGACGCCCACTGGTAAGAAGATCCTGACAT
TGCGAGAGGCGTCGAGTGCGGTGCCGATGGAAATGAGTACGGCATCGTCAGTGTCTGGTGCAAGTACAAGTTCAGGGGGTGACATGGTGTTCCACGCGAT
CCAGTATCACGTGCGTCAGCAGCGCGTTGCCGCCATCGTGCAGTTCCGCAAGCGCATGTTGTACTACATTGACGCCAAGACTGGTACGATCTCGGCCACG
CACTGCAGCGAGTGTCTGAGCGCTACTCTGGGTCTCCGTCTCAACGAGGCACACTGCACAGCGCTATTCGCATACATCAACCAGCTTCCTGAAGCAATAA
CGTACGACCTGAGCAGTAGCACTGGCAATGGTCCCAATAACAGCATCGGGTCTCGTTTCTTGCAGCAGAGCAATAGCAGTAGCAAAGGCAACACACGCAT
GGGGATCCGCAAGTTCTTCCACTGCGTGCTTGGCGCATTGAGCCCCGCATGTCTGGACGCAGCACAGCGCGTGTTCCAGGCGCTCCAGCGTGCTGGGAAC
GGACGCGTGTTCCCCGTGGCGCTTGCCAAGAGTTTCCAGGCTGCGCGGCATCCGGACGTGACGCTCGGCGGCGCCAGCANNNNNNNNNNNNNNNNNNNNN
NNNACATCTTCCAGGAGTTTGCGCTCAGCTTTGAGCTCGCAGAAAGCGGCGCTAGTGGAGCTGGGGATGGGGCCGTAGCGTTCGAGCACTTTGAGGCGTA
CTGCGTGAACCTACGCGCCGTCGTCGGCAGTGACGAGATGCTACAGCTCCTGCTGCGCGACTGCTTTGACGTGAGATGA