Transcript Name :
Phyag_g3632
Orientation:
(-)
Number of Exons:
1
Description :
conserved hypothetical protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
fprintscan predictionP-Valprediction_id
Ankyrin repeat1.7PR01415
Ankyrin repeat1.7PR01415
Profile scan predictionP-Valprediction_id
Ankyrin repeat-containing domain48.093PS50297
Ankyrin repeat14.639PS50088
Ankyrin repeat10.82PS50088
Ankyrin repeat9.831PS50088
Ankyrin repeat12.369PS50088
HmmSmart predictionP-Valprediction_id
Ankyrin repeat170SM00248
Ankyrin repeat2.9SM00248
Ankyrin repeat0.002SM00248
Ankyrin repeat0.058SM00248
Ankyrin repeat0.0011SM00248
Ankyrin repeat2100SM00248
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Ankyrin repeat-containing domainIPR020683
*** None ***
InsideOutsideTMhelix
1-535
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
protein bindingGO:0005515IEA
*** None ***
*** None ***
Sequence
        1608 bases(100 bases per row)
atGAGCTGGATCGACAAGTACGACGTGGCTGTGCCCTCGTACCAAGTGACCGACGGCAaggtcttcttcgccatcaaACTCACCAAGAACGATGCACGCG
CTCAAGTgcccacgtcgtcgtcgcttgaTGGCATTTGCACTACCTTGCGCTCGTACTCGCAGTTTCGACGCCTCTGGAAGACGCTCAAAGAGCGCGTGAA
CGAACCGAACGGACGTCGACTCCACTTCGGTTTGACGCACACATGCCACTGCGCTGACGACCGCTGCGAGTTCGACGCGCTGTACCCGATGCTGCAGACG
TTCCCGTTCCCGTCTCGACGGTCGCTCCGCTCGAAGCTTACAGGTCTCGACCACTCCGCTGTCAACGAACGTCGCGATGCCCTTGCAGCTTTTGCGACGC
TTTTACATGAATTCTTCAGCACTTTCGCGAGCACGACATTACGCGAGAAACTGCAGAGCGGCAGCTGTTTGGTGCTCAAGACGTACGCCAACTTCCTGGG
TGCTGCAGAGCACTTCCCGATAGATACGTCGGTGGACTTGCATCGTCCGTTAGCGCTGAATGCCTGGAGACAACAATGCGCTGATCAGATGCTGgggcaa
gatgaagaggaagacgacggtggATTCAGGAACAGTTTCTCGGAGATCAGTGAAGTCCACCTTAACACCCCACGTGCGGTCGAGCCTCGAATTGCAGAGG
ACCTGGCGCCTTCATCAAATCAAGAGGAGGATCCAGAACCCGAgagcgtgacgctgccgtcgctaCAGGTCAAGACTGTGCGTGTCCACACCATGCACTC
GTTCATGGAGGAGTTCTGTGAGCACGTGCTGAGTCAGTTCGCGAGCGACATTGATGAAGTAAACTCGCCCGACCTCACACAGACGCGCCGCTGGGAGATC
TGCCTGTACGTGGCGTGCCGTATCGGCCACACGTACGCAGTTCAACTCATCCTGTTCAACTACGCTGATGCCAACACGGCCATGGCGGATGGTTCTTCGT
GTCTACACATTGCGGCCCGCATGGGACGGACCGACATTGTGGCTCTGCTACTCGAGGAAGGAGCGGACGTGAACAAGGCGAACGAAGCCGGTGTTACTCC
ACTCATTGCAGCCTGCCGGAACGGATGCGTCGAAGTCGtgaagcttctgcttgacGCCAATGCCAAGGTCTCGGTTTGCAGCAACCGGGGCACTTATCCA
CTCCACGCCGCCATCGTGAGTCAGTCTCAAAACCCCGAGAGAAATTCTCGAGAGTCTCTCGAGATCGTGTCGCTACTCGTGGAGCACGGCGCCAACGTGA
ATGTTATGACCGCTAGTGGCATCACGCCACTGCATTTCGCCGCCAAACTGGGCTCGTTAGCCGCAGTggagttcttgctgcgccacgacgccgacCCAGA
GAAGCGCACCaagaacgacagcgacgccatgATGATCGCGGAGGCCAACGGCCACGCCACCATCTGCGAGTTGTTCCAGCGGTTCTCGGGCATTGTTTCG
AGCGACCAAATGGGATCGGACTACCTGCCCAACATCAGCGAGACCGACAAGTCGCCCGACATGGTGCGCATGCTTTCGCATCGTCGACTGTCCCGTGCCG
CAGCCTAA