Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_437-snap-gene-0.15
Orientation:
(+)
Number of Exons:
6
Description :
Small mechanosensitive channel family protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-1
48-59
110-131
184-184
21-24
78-86
155-163
2-20
25-47
60-77
87-109
132-154
164-183
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1648 bases(100 bases per row)
ATGATCGCATTATGGCGGATCGGCGTCGCGGGCGCGCTCGCCGTGCTCGCGTACTTCCTCTCCAAGCCCGTCATGGAGGCGCTGCTCGCCATGCTNNNNN
NNNNNNNNNNNNNNNNNNNNNCATCGGCAAAGGCTTCCAGTACGTGGCTCTCTCTCTCGCTATATATATGTAAATGCTGTACTCATCTTGTGCATGCGCA
GATGGATCGCGGACGTGCAGCGGTACATGCTGCTGTACCTGTCATGGATCTGCTTCGCACTGCTGCTGATCTTGATCGCGGTCAACGTGCTGCAGCTGGG
CGACGCGGCCGACAACGCCGTCTCCAAGGCGCTCTACTACTTCCTCGCCGCGCCCGTCGTGCTCGGCACCTTTGCGCTGCGCAAAGTCGTCGCCAACGTG
CGTATAGGCTATCTACTGCCATGGGTGGCAATCGTTCTGTGGGTGTGGGTGTATAACGTGTTGTATGGCTCGGTGTGGCAATATATGCAGCTTATCATCC
GCTATCTGAAATGGGACCGCGGCTCGACCGACTACGACGCCAAGATCTTTGTCGTGACTGAGGGCGTGACGGTGCGTATATCATATCACAATGGTGCTAT
TGCATGCTGCTCTCTTGGTTCGCACGCTTGCCGACACGACTCGTTTTGGTTTCATGACTTGCCATGCAGTTTCTATGCTTTGTGCTCATCGTGGTCGAGA
TCTTTTACATTTTCTTCGTGTCGAACGAAATGGCGAGTTTCCTGCTAGTCGAAGTGCTCGTATGTCTCGAAGTCCTTGCGTTATGCGCAGGCTTCACCAC
GGTGCGTTTGCTCTGCTGTGTATGATTTTATCCATGGTGTATCCTTCCAACCTCCTCCTCTCAACATTGTGCATTTTTGTTCCTACTTGCAGCTCAAAAA
TGTCGCGACGGGGCTCTTCCTCATCTTTGTCGAACCCTTCCGCACGGGCAGTTGGTGCCGCCTGCAGCAACTGTGTGGCTTCATCGAAAAGGTGTCGCTC
GCGCGCACGATCCTGCGGCGGTATGACGGTGCGCTTGTGTTCATCCCCAACGGTATCTTCGCCGACATCCACCAGACGAATGGGAACGCCCAGGACGCAC
AGCTGCATGAACTCGTGCTCCAGGTGCATCCGGCGACGTCGATCGACAAGATCCACCAGCTTGTGGACGAACTCACGACCATCGTGCCGCAGTACGCCAT
GCCCGAGGACTACTCAATGAGCACTCAGAGCCACACGACGTTCACGCGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTACATGCATCGCCACAACACGCTCAGTGGAGCAGAGAGTAACACAACGTA
CCGCGTCGTGCTCCAGGCCATGTACCGCGTCAAAGTCATGGTTCTCGTCGATCGCGCGCGGTTCTCGTCCCTCGAGGCTGCCAAGACCGAGGTACGAAGC
TTTTATTTCTGTAACAAGCTGCTGCTGCTGTTATCCTCACAGCAAGATGATCATGATTGTGTATATTTGCAGATAAATATGTCGATTATTGAGAGTCTTC
AACGCATTGGCGTTGTCGCGCGGCAAACCGTGCACTGAAGCCATTTTC