Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_216-snap-gene-0.18
Orientation:
(-)
Number of Exons:
3
Description :
Mitochondrial Carrier (MC) Family
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-112
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        1112 bases(100 bases per row)
ATGCCCGTGCTCACGAACGTTGGCGTAGTGACGGCAGCAGTAAGCAAAGACGTGCAGTATACGGGTATGGTGGACGCTGTGCAGAAGATTGTGAAGGAAG
AAGGACCGGGGGCGCTCTGGAAGGGGGCGACGCCCGCGCTACTGCGGCAAGTGTCGTACACGAGCATCTGCATGGTGCTCTACGAGCCGCTGCGCGATTT
CTTTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTTTGCCGGCG
CCATCGGCATCAGTCTTGCAAACCCGTACGTTGCATTTTTGCTGCATGTGTTGCATTGTGTGCGACTATGGGGTGTTGTCATGTCGCCGCCCTCGTCGTC
ATTTTGCTCTTTCTCTTTGATGGTCGCATGGACATCTGATCTGATTCTATGGCTACTTTATTGTCTACTTCCAGAGTGGATGTCATTAAAGTACGCATGC
AGGCGGATCGAACCGGTGCGTTGTACCGTGGCGTGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAGGGCTTCC
GCGGCTTCTTACGGGTACGCTTTGGCTCCATTGAGAGTATGAAAATTATGGGGATAATAATGCAGCAGCCGCTCATCCTAACAGCACATCCATTACGTCT
CGATAGGGCATGCCACCGAACATTCAGCGCGGCTTCANNNNNNNNNNNNNNNNNTGCGGCCGAGCTGGGCACGTACGATCACAGCAAAGAGTGGCTCATC
ACGTCAGGGCTCGTGCGCGAAGGCGTGTTTGCGCACACGGGCGCGAGTTTCGTTGCGGGCTTCGCGGGCGCCGCAGCATCGAACCCGATCGACGTGATCA
AGACGCGGCTCATGAGCCAAGCGACGGACGCCAAGGGCAAGGGCTCGATGTACTCAGGCATGGCGGACTGCGCCCGGCAGACGTTCCAGGAGGGCGGCGT
GCAGGCGTTCTACAAGGGCTTCGTGCCCAACTGGATGCGCAAGGCGCCCTGGTGCATCATCTTCTTCGTCACGTACGAGAAGTACCGCGCCGCCTTCCTG
CCGCGGGAGTAG