Transcript Name :
Pytul_var.sporangiiferumsnap_masked-pug3_contig_216-abinit-gene-0.21
Orientation:
(+)
Number of Exons:
6
Description :
Dynein heavy chain
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-2132
*** None ***
PositionContextScore
1276LLSRIMR|DL0.52
TypeScore
nuclear478
GO
*** None ***
*** None ***
*** None ***
Sequence
        11215 bases(100 bases per row)
ATGTACACAAATGTGTCGACATCGTTCAAGTTCCACTCGGTCACAGCGGCGCCAAAGACACTGGCATTTGGCCCGTGTTTGATCTCGTCACTGAACGATA
ACTGCTTGGCGGAATTCCCGACAGCGTTTATCATCCAGTCGAGAGACAAAGATGACAACCCGCGTGATTGCGGCGGAGACGAATTTACGATCGTGCTCAA
GTCATGCGATGAGCCAAGCAAACCAGCGACATCGGAAGCTGAGGATCCTCCAATCACGAGCATCATTGACAAAAATGACGGCACGTATGTTGTCACGTTT
GCTGCCCCTAAAGCTGGCAAATATCAGCTCTCCGTGGAATTCAACGGAACCTTTGCCGGCACTGCAGGTCCCGTGCGGGGGTCTCCGTTCACGATTTTCT
TTCAGCAACCGACTGAAGAGAACAAAGCTCGCTGCATGCCACCGCTTAATAGCGAGAAAGACATGGACTCGTCTGATCTCATCCGTCGTCTCATGGCGAA
TATGAACAAACGCAATGGTGAATTTCGCCGCATTCTCATTGATTTACGGAAAGATATCCCGAGTAATGAGACCGACGGCCTCGAGACATTACGAAAGGTG
AAGGAAATTATCCGAAAGTTAGAATTGGAGAAAGAAATCAATCATTTGATACTTGACCAAGTGCGCCAACTTTTTGGAAACATCAAGAAAATTGGTGGAC
ATGTCGACAAAGAGCTTGTCGAGATTGAGAACATGGAAAAGCTCTTCTTGGACGTGCAGAAGCAGATACCAACGACTGAGCAACGCACGCAAGAGCCGAC
CCGCATTTTCAGCGAGAAGACTGAGGAGAAAATCATCGCTTACGAGAAAACGATCATCAAGAAGATGGAGACGATGAAAACACTCGATTTTTGGTCCTCA
AAACTCGATCCGGAGAAAGGATTGGAGAAAATCGAAAGCTACTTGGTGGATTGGGAGATGGAGATGAAGAAATGTGAAGAAAACACCAAACTGTGCTCGA
TTTTTGGCTTCCCTCAGCTCATGAACGAGTCCTTACGCGTCATGGATCTCATGCGCGCTGATGCTGAAGGGATGAAAACCGTGTGGGCGATTATCAAGCG
AGCGAAATCATTCTTTGTGACGACTGATCAGATATTGTTTAAGAGCGTCGATGTGAACTCGCTTCAGATCGAAATTCAGTCCATGTTGAAAGAGTTGAAG
AAGATCCCGAAGGAGATTCAATGGTGTGATGCGTACACGTCGATCCTGAAGGAATGCCAGTCTTTCGACAAGACGCACCCATTGATCCGATGCGTCTCGT
CAACGTACATGCGACCAAGGCATTGGCAGCGGATCATGGCCCACACAGGCCAGTTCCCGACACCCGATGAGGATCCAGAGCAGAAGCTGTCGCTCATTCT
GAGCAAGAATCTGCACAATTTCAGCTCTGATATCACGGAAATTTGCTACGAAGCAGAGAAAGAACAGGAATTGGAGCTCCGCTTGATTGAACTCGAGGGC
CTGTGGGCAGAAGTGAACTGGGAGATGACCGCATACAACCCTGGCGCACCTGAGGAAGATGTTGTTCCTCTTCTCAAAGTATCGGAAGAAAACTTCGAGC
TTTTGGAAACGCATCAGATTGATGTCCAGGCGATGAGTGCGTCGCCATACCAATCGGAGTTTGAGCCGCGTGTCGCAAGCCTTCAACTAGGGTTGTCATC
TATTAATGAAGTCGTAGTGTTACTCGGTGATATTCAACGTTCATGGAGCTACCTTGAGCCGCTGTTTATTCAGTCGGAAGAAGTGAAAAAGCAACTTCCA
GAGCTCACCGCCGATTTCGAAGACATTGATGTCGAAGTGCGTAAGATTCTAAAAAAGGCATGGAGGACGTTCAACGTTCGTGAGGCATGCACGGAACCAG
GGCTGATTAAACGCCTGGAGTCTATTGTCGAGAAACTCGAGCTGTGCAAGCATCGCCTGAAGGAATTTTTGGATGGGCGCCGTCGTCAATTTCCTCGATT
CTATTTCATGTCGGAAGCTGATCTGTTGGATATCCTCTCGAATGGATCGCACCCTGACCGCATTATGCCGCATTGTTCGAAGATCTACTTGGCCACAAAG
ACATTAAATCTCGTGGAGCCCGAGGGTGGTGGGCGTCCCGTTGCGACAGCGTTTGTTTCGGGCGTGGGCCATGAAATCGTGGACTTCGTCGAGCCGCCTG
TGCTTGAAGGAGAAGCTGAAATTTACCTGGAAACAGTGATGCGCGCGATGCGTTTCACGTTGTTCAAACACATCGAACGCTCGCTTGTGAAATACACTGA
AATGGAGCGTGTGGAATGGATCAATTTCAAAGACGCAAGTGGTAAGCCCATGGATGCTGCTCAGATCATCTTGCTCGCAGCTGGTGTGCATTATGTGCAG
GAAGTGGAGAAGTGCTTTCGAGAGATGCAAGGAGGTGACAAGGAATCACTCCAGCGGTACAACAAGAAGCAGGAAAAACAACTCGAAGACTTGATTAAGC
TCACCCAGAGTAACATCTCGTCTGCTGAACGTCAGCGCGTGATGGTGCTGATCACGATGGATGCGCACGGACGAGATATCGTCGCAGGCATGATCCGTGC
TGGCGTCGACGATGCAACGTCGTTCCAATGGCAATCGCAGCTGAAGCACTACTTCTCGCCAACGCAGGGAAGCTTTCTGAAGCGTGACATGAATTTCCGA
GGCATCAACAACTCTCGAGCGCAGATCCTCATTTGTGACGCTGGCATTCCTTACGATTACGAATACCTCGGCAATGGGCCACGTCTTGTGATCACACCAC
TGACAGATCGCATTTACGTGACGGCAACGCAAGCACTAAACTTGCAAATGGGATGTGCGCCAGCCGGACCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNACAACAAAGGATCTTGCGAATGCGCTCGGTAAAGTGTGCTATGTGTTCAATTGCTCGCCAGAAATGGATTTTAAGAGTCTGGGCAACATTTTCAA
AGGGCTTGCGTCTTCTGGGTCGTGGGGTTGCTTTGATGAGTTCAACCGCTTGGTGCCTGAAGTGCTCTCGGTGTGTTCGGTACAGTTTAAAGCTGTGTGT
GATGCTTGTAAAGCGGATGACGAGAAATTCATCCTCGAAAATGATGAGGTTATGTTGGACCCGACGGTGGGAGCATTCATCACAATGAATCCAGGTTACT
TGGGTCGTTCCGAGTTGCCTGAAGGACTCAAAGCGCTGTTCCGTCCGATGACCGTCATGGTGCCAGATCTGGTGCTGATTTGCGAAAACATGCTCATGGC
TGAAGGGTTCACGCAGGCGAAAATCCTTGCGTCCAAGTTCTACGGTCTCTACTCGTTGCTCGGTCAGCTTCTCTCGAAACAGTTGCACTACGATTGGGGG
CTTCGAGCTGTGAAGAGTGTGTTGTGTGTGGCCGGTGCCTTTAAACGTGCTGAGCCCGATATTCCCGAGATCGATCTTCTCATGCGAGCGTTACGTGATT
TCAACATCCCGAAGATCGTCGCGGAAGATACCGTGATTTTCTTCGGTCTCCTTGGCGATCTTTTCCCGCGCGACAGCCCAAATGTCGATGTGCGCAACGA
TCCGCCTCGAAAGCGTGATATGGAGCTGGAATCCATGGTGCAAGGTGCGTCAGAAGCAATCGGAAATTCGCCTCGCCCTGATTTCATGCTCAAGGTCGTG
CAGCTCTCAGAATTGCTTGCGATCCGACATTGTGTATTTGTGATGGGACCGCCATCATGTGGTAAAACGGAGACATGGAAGACGCTCAAGAAAGCGAGAG
AGATCATGGGCACACCAATGGAAGTGCAGGATCTCAACCCGAAATCCGTGAGCACAAATGAACTCTATGGCTACATCGTGCTGAAAACGCGAGAATGGAA
AGACGGACTGCTGTCTCGTATTATGCGTGACTTGGGCTCTCGTCGACGAGATAATGGTGACGAAGACAACAATCCGAAATGGATCATCTTGGATGGTGAT
TTGGATGCAAACTGGATCGAGTCGATGAACTCGGTCATGGATGATAATCGCATGCTCACGCTGGCCTCGAACGAGCGTATCCCACTCAAGACCCACATGC
GCATGATCTTTGAAATCCGCGATCTTGTGTACGCGACACCAGCAACGGTCTCTCGCGCTGGTATCTTGTACATCTCGACCTCTGAAGGTTATCAGTGGCG
GTGTTTGATTGATAGTTGGCTCGAGCGCCACTGCCAAGTGCCTCATGACCATCGACTGAAGAACATGATGTTCACCCCGGACATTCGGGCAAAATTTCAA
GGCCTCTTCGACCAGTACATTGAACCAACACTCAAATTCTTCAAGAAAAAACTTGTACCGATTGTGCCTGTCGAAGACACGACCTTGGTCACAAACTTGC
TCAATATGATCGACTGCTTATTAACCCCGCATGTGCTCGAGGACTACACGGTGATGCAAAACAACTTTGTGTTTTGCTGCGTGTGGGCGTTTGGATCGAT
TCTAACCATGAGCGACGACGGTACCGATTACTCGGCCGAGTTCAGTAACTGGTGGAAAAACCAGTGGAAGGATGTGAAGCTTGTTGCGTCCGCGAGCAAC
ACAGTGTTTGATTTCTGGCTGGACCCGGAGTCGTCGAAGTTCAATTCCTGGTCGAAAAGTCCCTACTTTTACACTGAGACGTACAAGTCGCCAAGTCCAA
TTAACCAGATCACGGTGCCGACGACAGAGACGGCGTCAATTGCGTTTTGGTTAGAGAATTTGATCAACAAGAGTATTCCTATTATGGTCTGTGGTCCCGC
CGGTACGGGTAAGACGCAAAACATCGTCGGAATGCTCAAGAAGCTCAGCAAAGACGAAGCCACGGCAGCATTTAAGTACTGCACAATCAACTTTAATTTC
TACACAACCTCGGGAATCTTGCAGCAGGCGATGTTTGGCCAACTAGAGCGCAAGACGGGCATCAACCTGGGGCCACCAGGCAAAGCTAAGTTGATCTATT
TCATGGATGATTTGAATCTGCCGGAAGTCGATCCGTACAACACACAGAGCGCGATCTCGCTGCTGCGTCAAGTCATGGAGTACAGGCACTGGTTTGACCG
TCAAAAGCTGCAAACCCAGAATATCCTGAATACCCAGGTCGTCGCAGGAATGAACCCAACCGCAGGCTCGTTCCTGATTGATCCTCGCTTGCAACGCCAT
TTCTGTACGTTTGCGATGGGTATGCCCGAAGCGCCAAGTCTCGTGACGATCTACGAAACATTTCTTGGCGGTCACTTGTCGAGTTTCTGTGATGAACTTA
GCAACGTGCAATTCTCGAATGCGCTGATCAAGGCTGCGTTGAGCCTTCATACCAGTGTCGTGAACACATTCCGCAAGACTGCAGCAAACTTCCATTACGA
ATTTAATGTACGGCACTTGTCGAACGTGTTCCAGGGCCTCATCGCGTCCAAGAAACAGCGCTTTACTACAACCGAAAAGTTCGTGTTGCTTTGGCTGCAT
GAGAGCGAGCGTGTTTACGGTGACCGTCTCGTGTGCAAGGCAGATATCGAAAAGTACAACCAGCTCGTGCAGCTTCAAGTAAAGCGATCGTTCCCAGCAT
GTAATACTAGCCGATACTACGCTGCCGAGAACTCGTGGCCGCTGATTTTCTGTCACTTCACGAAAGATGGCGACCCAGAGTACGACCAGATCATGGGCAC
GAACCTCGATGACTTGAAGATGAACCTGCAGGCCCAATTGCGTGATTACAACAACAACGAGAACAATACGGCAATGCATTTGGATCTCTTCGACGATGCC
GTGAAGCATGTGGCACGAATTGTTCGTATCTTGCGCAATGAAAGCGGTCACGCGCTTCTCGTCGGTGTCGGTGGAAGTGGTAAACGTTCGCTGGCACGAC
TCGCGTCTCACATTTGCGGCTACCTCGTGCGTCAGATCACGATCAGTTCCAAGTACGGTGAGAACGAATTCAAGGAAGACCTTCGGAAAATGCACATGAA
TGTTGTCGAAATGCTCTCGCGTAATGAAGAAGATGGCGGCATTGTGTTCATGCTCACGGATTCACAGATCACGAACGAAAAGTTTTTGATCTACTTGAAC
GATCTGCTGGCCTCGGGTGAAGTTCCAGACCTGTTTGCGATGGAAGATATGGACAATATTGTGAATTTGCTGTCTCCTGTCGCTGGCACGAAAGACCGGA
AAGAGGTGGTCAAGTTTTTTCAGGCCGAGATCCGCAAACGCCTGCACTTATGTCTGTGTTTCTCTCCCGTGGGCGACGATTTTCGAAGTCGCGCACGCAA
ATTCCCTGCGCTTGTGAGTTGTACCGTCATTGACTGGTTCCAGCCATGGCCAAAAGAAGCGCTCCTATCGGTCGGCCGTGAAAAGCTGAAGGAAATTTCC
GACTTGTTGGGCTCGGACGACTCTCGCGCCGGCATTGAAAACTTCATGCCGTTCTCGTTCCAATCGGTCAACCAGTGTGCTGAGCGCTTCTTCCAAGTGG
AGCGACGGTACGTTTACACGNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCGTACTTGGAGTTGTTGCAACTTTACAAAAAGATATTGCGTAAGAAAGTG
AAAGAGTATGGTGCAGCTATCGAGCGTCTGGAGAAAGGTCTACAAAAACTCAAAGAAACAGGAGAGACCGTAGCACGCCTCGAAGTGGAATTGAAAGGCA
AGCTTGAAGCCGCGGAAGACAAAAAAGCAGTAGCCTCAGCGATCGCTGAGACGGTCAACAAAGAGAAAGCGAACGTCGAAATTGAGAGTAAGAAAGCAAG
TGAAGAAGCCGCCAAGTGTGCGATCATCCAGGCCGAAGTCACCGAAAAGCAACGATCGACCCAGGAAGATCTCGCCAAAGCAGAGCCTGCTGTCGAGCAA
GCTATGGCTGCGCTCGACTCCCTGAACAAAAAAGATCTCGGCGAATGTAAGACAATGTCAAAGCCACCTGCAGGTGTCGACGATATTTTCGCCGCAACCA
TGGTCCTGCTCGCGGGCGTACATCCAAATGTGCAGGTGACGAAAGCGGGTAAAGTAAAAGATGCCAAGTGGGATACTGTGAAGAAGCAACTCTTGGGTAA
CATCCCCGAGTACATCGACTACCTAGTCGGGTTCAAGCAAGTCGTCGATGAAGGTAAAGTGCCCGTCGTGAATTGGAAAGATGTGCGTGAGTATCTGGAA
AAGGAACACTTCAACTACGATACCATTTTGACAAAAAACAAGGCAGCAGCAGGTCTCTGTTCCTGGGTCGTCAACATTGTCATGTACTACGATATCTTGA
TCACGGTCGAACCAAAGCGACAAGCGCTTGCGGCCGCCAACTTGGAACTTGAATCTGCAAACAAGCGCCTGCATGAAGTCACGACGCTTGTCGCTGAGCT
ACAAGCCAAATTGGACAAGTTGCTGGAAGAAGCTGCTGCTGCAGAGAAAGAAAAAGAAGATGCGATCAACTCAGTGGAGCAAGGAAACCGCAAGATGAAG
CTTGCGGGGACACTGACGAATGACTTGTCGAGCGAAAATGTGCGTTGGGGAATTAATGTGCTGCAACTACAGAAGGAGAAAGATCTGCTCGTAGGCGATG
TGCTCTTGGCATCGGCGTTTATCTCATACATTGGACCATTCACGAAACCGTTCCGTGATGAGCTGATCAACAAACACTGGGTTCCCTTCTTGCGGAAAGC
TGCGAATGGAGAGAGTATCGCAATGTCGGAGGAGTCGAACCCACTCACAATTTTGACCGATGATGCGCAAATCGCGCAATGGAACACGCAAAAGCTCCCG
TCGGATCGTGTCTCGACCGAAAATGGCGCCATCGTCGTCACAACTGTGACCATGGGTCGTCGTCCACTGATCATCGATCCACAGCTGCAAGCTATTGCGT
GGATTCGTGAAATGGAAGCGCACAATAACCTGATCATCGTTCGTGTTGGTCAAAAGATGTGGATCGAGCGCTTAAAGTCTGCGATCGGCACGGACGGTGC
ATTCCTGATCGAAAACTTGGGCGAGAAGATTGATCCGATCTTGGCGCCCGTGATTCAGCGATCGACATCTCGACGTGGTGCTCGGTACGAGATCCAAATT
GGAGATGCCTCAGTGCCGTACAACGACAACTTCCACCTGTATTTGCACACGAAGCTGGGGAATCCGCACTATCCTCCTGAAATTCAAGCCGAATGCACGA
TAGTGAACTTCACGGTCACTATTCTCGGTCTAGAAGACCAGCTTTTGAATCTCGTCGTGTCGAAGGAGCGGAATGATCTCGCTGTGAAGCGAGAGAAACT
CATTCAGGAGCAGAACAACGGAAAAATCGAGCTCAAAAAGCTCGAAGATGATATCTTGTTCTACCTGGCAAGCGCTGACGATGATATCACGAACAACCAG
CCGCTGATTAGTATCCTCAGTGACACCAAGTACAAGGCGCAATTAACGCAAAACAATATGGAGGCGGCTAAGAAGACCCAGGAATCCGTCAACATCACGA
GTGAAAAGTACCGGAGCATTGCAGCCCGCGGCTCACTGCTCTTCTTCTTGATGAACGATATCAGCAAAGTACACTCGTACTACATTTACTCGTTGGCGTC
GTTCCAGCAAGTGTTCTTGTCTGGCATCTATCGCGTTCCAATCAAGAAATCTGAGAGCGAACCTGTTGCCGGCGGCGAAGGAGAAGAAGGAGCAGCTCCT
GGTACAGGAGGCGGTGAAGGCGAAGTGCCCGACCTCACGGATGAAGAAATGCTGGCGCGTTGCCGCATCCTCATGGACAGTATCACGTCGTGTGTGTACA
ACTATGTGCGTCGTGGACTATTTGAGCGTGACAAGCTCACAGTCGCTACGATGCTCACGTTGAAGATCCTGCTGAAAGACGGCTTGCTCTCAGATTCAGA
AGTCGAGTATCTCTTGATCAGCAAATCGCATCCTGATGCTGGGAATGCCGGGTCAGCCTCCGAGTGGCTTCTCGNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAGCGCTCGAGGCGCTCAAGTGTTTCCAGGGATTAGGCGATGCGATCCAGAATGACCCAGATGAATGGCGGAAATGGTTTGCCACG
GAAGACGCAGAGCGACAGAAGCTTCCTGGGGATTTCGTTAAGCTCTCATCTTTCCAGCGCATGATCCTGCTGCGCGCATTGCGTCCAGATCGCGTCACGA
ACGCGTTGCGCACGTTCATTTTGGATTCGTTGGGAGAAGAGTACGTGAGTCAGCCTCCTTTCAACATGGAGGCCACGTACGAGGAAACGAATTCATCGAT
CCCGATTTTCTTTGTGCTGTTTCCTGGTGTTGATCCGACGCCGTGGGTGGAAAAGTTAGGACGTGCCAAAGGTGTTAGTCTGGAAAACGGAAACTTTATC
AATATCTCGATGGGTCAAGGCCAGGAAGCGTACGCGGGCGAGTCCCTGAAGAAGCTTGCAACGGATGGCGGATGGATCATTCTCCAAAATGTGCACTTGA
TGCAATCTTGGCTGCCTACACTGGAACGCCAATTGGAAGAAGTCGCGACCGAAGGTGCCCATGAGAACTTTCGGTGTTTCATCTCTGCGGAACCCCCACC
TCTCCCAGATATGCTCAATATTCCTGAGTCGCTCATGCAGAGTTGTATCAAGGTCGCGAATGAAGCGCCGTCGGATATTCAATCCAACTTGCGACGCGCC
TGGGCGAATTTCAGCGAAGATAAAGTTCAGGCATGCACGAAGCCCTCGGATTTCAAAGCGTGTCTATTTGCGCTGTGCTGGTTCCATGCGATCGTGCTTG
GACGCCGCCGCTTTGGGCAACAAGGTTGGAGTCGTGCGTACAGTTTCAACACAGGCGATCTCACGATTTGCGCGAATATCCTGCACTCGTACTTGGACAA
CAACCCGAGCGTGCCATGGGACGATTTGCGGTATATCTTTGGCGAGATCATGTACGGCGGGCACATCACGGACTCTTGGGATCGACGCACCAACAACACG
TACTTGACCGTGCTGATCAATCCAGGGCTGCTCAACGGCATGGAGCTCGGGCCTGGCTTCAAGTCGCCAAACCCGGAAGAGTTCAACTTTGCAGAGTACG
CGAACTACATTGAGAAAAACATGGTGCCGGAGGCACCACCGCTCTTTGGACTGCATCCGAACGCTGAAATTGGCTACTTGACGACGACGTGCGAGACATT
GTGCTACACGATCGTGACCATTGGTGGCGGAGCTAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAGACGTCTGCGCTGCGGCACATG
ATCGATGAGTTTGAGTCGCGATGCCCAGAGTTTTTCAGTCTCCTCGACCTCACTGAACTCGCGACACCGTTGCTGACTGAGGAGCATGGCCCTTTCGTGG
TCGTGGCGATGCAGGAATGCAGCCGCATGAACGTGCTGCTTGAGGAAATTCGTATCTCCCTGGGGGATCTGAAAAAGGGTCTCAATGGTCAACTCAATAT
GTCTCAGGCCATGGAAGACCTCGCCACGGCGATGTCGCTGAACGAAGTGCCTGGACGGAATCCGTTTTCGCAATGCAAATGGGAAAAGAAAGCTTGGCCG
TCCAAGAAATCGCTCAGCGGGTGGTTCACAGACATGGTGAAGCGCTACCAGCAGATGCAGGTCTGGTCGACGGACTTCGTCACGCCTTTCTCAATTTGGC
TTCCCGGTTTATTCAACCCGACTGCGTACACCACCGCGTGTCTCCAGGTGACGTCGCGAAAAAAGTTCATGCCGTTGAACCAGATGACCGTCGAAACGCA
CGTGACGACGTTCCAGGATCCGTCGCAGGTCACGTACTACCCCGACGACGGCGTGTTTGCCCACGGCCTGATCCTTGAAGGCGCTCGATGGAGTACGCTG
GACGAGATCTCGGAGCGATTCCACGTCGGCTCCTCCCCGTCGACCGAGTGTGGAGGCACGTTGCTCGATAGCAATCCAAAGGAATTGCTCTGGATGCTGC
CGGTAGTGTACGTGAAGGCCGTGCAGACTAAACCGAGTTGGGAGCCTTCGGCTGTCGGGTACTTGCGCCACGACCCCAGCATCTACGAATGCCCAGTGTA
CCTCACGCGGTTCCGAGGCCACACGTACATCTTCTTGGCGACGCTGCCCACCGACTGCGGCGGTGAGAAGTGGGTACTTCGTGGCGTTGCGATTCTGTTC
CAGGACGACAACTAG