Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_198-snap-gene-0.26
Orientation:
(-)
Number of Exons:
7
Description :
Conserved gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-381
NN-scoreoddsWeighted Score
0.8785.2480.01
PositionContextScore
15IWLRSRR|FH0.578
148AARRSRR|EQ0.511
223NATRVRR|GS0.53
TypeScore
mitochondrial652
GO
*** None ***
*** None ***
*** None ***
Sequence
        1924 bases(100 bases per row)
ATGGCGCTTCGATCGAATGGGAAAATCAACCGCATCGTGCAGGCGGCGCTCTTGAAGACGCTGCTTCATGCGATCCGAAGAGGATCGGTGGAAGGTGTGC
GCGTCGCCATTGAGCGAGGCGTGGTGACGCAGTATATCGACAGCCGTGGCCGAAATCTGGTCATGTAAGTGGAGAGACAGGCAAACTTGCTGATATGAAC
CTGCAGTTAGTCTAATTTCGTGTTGTTTGCTGTCTGCTGCTTGAATAGGCTTGCTGCGAAGTGTGATACAGATGCGCGCTTGCAGATTGCGATCATCTTG
TCCGACGCGGGCTGCGATATCAATCACACGGACCAATTGGGATGGAGCTGCTTGCATTACGCCTGGTAAGCACTCTTTGGTCGTGATTTTGGCCCCGTTA
CCCAGGCTCACAGTGATTTTCTTTCTTGTCTGCAGTGCCAGTGGAGCGCTTGACGTAGCAACTGAACTGATTCGACGGTAAAATGCCAGGCTAAATACGT
GAAAAAATTGCATGGTGACAAGTGCTAATCGCTGATTCTTGTTTCATGTACAATGCAGAGGTGCTCGAGTGGAATACAATCCATATGGCTACGGTCCAGA
AGATTTCATTATCCCCAAGGTCGCTCGCGCCAAGAGTCTATTGCAGCACACAGAACAGCTTCAGCACGAAGCGAGTGTCAAGTCTTGCTGGGACTTTTTC
CGCAAACACGCAAAGAAGACGGGATACAGCGTGAAATGCCGCTCAGTACGATGTTTTACCTTGCTGCGCTAAGTCGCTAATCCTGCACAGACTAACGACG
GATTTTGTTGGCATTGATAGCATTGTGACTTAGGCAAGCCTCTGAAGATTAGCTTTGAAGCTCCACCTGGCCACAGCTCGCTGGATCGAATTCGTGTCAT
TGATATGAATTCGGAGGTCCCTCTGTGGCTCCAAGTGTCCAAGAACTTCAGCATCCCACCTGGAGATGTTGGCTCGATCACTATCGACTCCGAGACTCTC
GATCGCCCTTCGCTCTACAGAATATTCTACGAAAAGTATGAGCCTACTCCTATCAAGCTGCCCGCCGAAGTCGCAGAGAACAACTTCAGCATCAAGAATT
TGGACACTGGAACCACTGTGTCGGTGGGAAGCGTGAACGAACTGGTTTTGCGAGAGCTGAGCAGCACACGCAATGCTAAAAAGTCGAAGGGTTTGTCCAA
CTCATCGAGGTAAGACCATTGCTTGCTCATAAAGGAAGATTGGTTTGGTGATTGACTAACGCTCCATACATTTACATTTACAGGGAAGCGCCAGCCACCC
AGAAGAGCACGATGCCGCGCAGGATGTCGACAACGAGATTCCGTGAGCTTGCTGAAACTGAACGAGAGTCAGGCGAGGAAGCAGAGGAAGCCGAATTTGC
GGCCGAAGAGACGATCACAATGACTGAGGTCGCCGAGCACCCAGCTGTCACCAGTATCACTGGCGTCTACAAGATTGTGGGCATGGCGATCGTCAGTGTC
TCCACGTTGAAGCGCGTGAAAGCAAATGAATATGAAATTGCTATCAAAAGCAGTGGCACGATGGGTCTTCACCTGGTAAGATTGGCTGGCTGCTTGTGAT
GTTTGCTTGTGTTGCAATGCTGACTCTCTGGCTGTGTTAATCTTGTAGGAACCAAAACGAGACAAGTCAAACAGATCCACTAAGCTTATCGTTCGCCGTA
GTTCTGGTCAGACTGCTGCGGTGAATCCCGGTGATTGCTTGGTGGCAATTGGACGAGCCAACATCGAGCATGCCGGACTGAAGCATACCTTGTGGGAGCT
CAACGCATCGAAGCGACCACTTGTTCTTCGGTTCCGTCGAGGAAATGTGAAGGAGAAGAAAAGCTTGTTCACCAGCATTCGCAATCTCTCTGGCCCAAAG
CCGCAAGCCGCCATCGCTGTGTAA