Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_163-snap-gene-0.18
Orientation:
(+)
Number of Exons:
8
Description :
Copper-transporting ATPase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
547-548
1-523
524-546
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        4032 bases(100 bases per row)
ATGGCGCGCAAGAAGTCCAAGCACACGACCAAGGCGAAGAGCGGCGGCAGTCATGCAATGGCATGTGGAACGGAGGATGCCCCTCTGAAGGATGCGGAGT
CGACGCCCGTGCTGACGCCGTCGTCGTCATCGCCAGCATCGCCGTCCTCGGACTCGAACGGGAAGGGGCAAGGGAGTGCTGCTGCCACGTTGAAGATCAC
GTCGGCATTCGTGATGGACGAGGGCCTGAAGATGAAGAATGGGGGTGACGTCGAGACCGTGGTGCTCGCTGCTGATCTGAAACAGGGGCATGTTGAAGTG
AACCTCTGTGGCGAAGATCACGGGAACGAAGCTGTCGTCGTTGAGTCCAATGGCGGTAAGCAAGCAAGTGGCGGATGTTGCTCTTCTGGTAATGCAGCCA
CTGAAAATGGCGAGACTGCAAATGGCAAGTCTCCGTGCTCGAGTTTGAAGGACGCAGAAAAGAGCGCAGGATCGTGTTGCTCCTCGAAGGAGGAGGTCGT
GGTGGAAGTGGTTGTTGAAGTGCCTGTGAAGGCGAGCTCTTGTTGCGGCAGCTCTTCATGCGCGGGTGCGCCTGCTTCTAGCGATGCGAACGGCAGTGCT
GACGTTGCTGAAGTCGTCAAAGAGTCTTATTGCTCAAGTGCAACGGCCAAGACAACGAGCGCTGGGTCGTGCTGTTCCAGTGAGCAGATGCCAGCAGCAG
TATCCAATGGAGTTCTTGAAAAGAAAAGGTCTTGCTGTGATAGCTCTTCGAATGCTGAGGCAGCTGAGGCACCCAAGGCGTCTTGTTGTTCGAGTACTGC
GGTAACGAAGAGCACCGGATCGTGTTGCTCAAGTAAGAAGGCTCCAGCATCGGAAGCAAATGGAGTGCCCGAAAAGAAGAGCTCGTGCTGCGGTAGCTCT
TCGCCAGCAGTGGCAGTTGTTGCGTCTCCAGCATCTGTTAGCGGCTGTTGTTCTAGCAAGAACAAGAAAAGCAGCCAAGCTGATTCGTGNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNGTCGAAAGATCCTGCGGCTACTGTTGCTACTATCGTGAACGGATCTGGCTGTGGAAGTCTGGCTGGGAAGGGTGACTCGT
GCTGCTCCGCGACGAAAAGCGGTGGCGCAAGAAAGATAATGGAGCGTAAACCCTCCAACAGCCATCCTGACAGGATCCGAGAGCGGCTGCTCGATCGTGT
GACGGAGTTCAAGAACGCGCGCGGGATCAGCATGGCGCAACACCATCTTGCGCCTCGGAAATCGGTCGCAGTGAGCATCAAGCCAGCGGATCTTTCGACT
TTGCGTCTATCGATTGGTGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGAGCGCCGACCGGGGATCA
TGGGCGTCAATATCAGTCTGTTGACGAGTCGGGGCGTGTTTGAGTACGATCCAAAGATGGTGTCTGAGAAGGCGATCGAAGACATGGTCGTGAGCCTCGG
GTTCACTGCTGGTGTGATGCCGAACGAGTCCTTCGTGTCCATTGTGCTGCACGTCGGATACGAGCACCCAGCCAAAGTGTGCACCATGCTACTCGAGATG
CAAGGCGTTATGTCTGCGAAGGAGACCGAGGATGCCACGCTCACGACGTCGCCAAAGCTGGGAATGGGAGCGCAAACGGCGGTNNNNNNNNNNNNNNTAC
GACCCAGAAGAAACAGGTGCGCGCAAGATCGTGCGCCAGCTTTCCGGTGCCGTGGGGTTCCAAGTGTACGCTTCGACGCCTCGGCCGCTTGCTGTGCAAA
ACGAGGAAGCAGAGGTGAAGAAATTCAAATTGTTCCTTATGGCGAGCTTCATCCTGTCGCTGCCGATCCTGATCATGGAGTATGTGTTGCCGCTGTTTGT
GGCGGCCGAGTNNNNNNNNNNNNNNNNNNNNGCGTGATATCGTGAGCGGTCTAAGTTACAAAGACGCCATTGGCATGGTGTGCGCGACGCCGATTCTGTT
CATCATCGCCTTCCCAATCCACGAGAGCGCATTCTTGGCGTTGCGCTACAGCTCCCGCGTGACGATGGACGTGCTCATCTCACTCAGTTCGTTCGCGGCA
TACATGTTCTCCGTCGTGACTGTTTTCATGGGCATTTTCCACGTCCATCCTGAAAGGTCAGAGACTTTCTTCGAGGTGACGGCGCTGCTCATTACGCTTA
TCCTTGTAGGTCGGTACATTGAGAAGATCGTTAAAGCAAAGGCATCAAACAGTGTCGATGCGCTTCTTCGAATCCAAGCGAAAACGGCGATTCTCCTGGA
AGCGAATGGCGGAAACGACAAGTCGATGAAGGAATCGTACATTGATATTCTCCTCGTCGAGCGCGAAGACCTCTTGAAGGTGCTCCCAGGCACGCGCATT
CCAACGGACGGTGTGGTCATTGAAGGCGCGAGTACGGTGGACGAGTCCATGGTGACGGGCGAATCGCGCAAAGTCGCGAAGGAACCGGGGTCGAATGTGA
TCGGTGGCACGATGAACTCGCAGGGCGTCTTGATCATGCGCGTCACCCACACCATCACGGAGTCGATGCTGGCGCGCATTGTGAACCTTGTTGATGATGC
ACAGTCGTCCAAGTGTCGCAGCCAAAGCGTGGCTGATGTGGNNNNNNNNNNNNNNNNNNNTCACAACATTCATTATCTCGATCTCGGTCATCATGTTCTT
TGTGTGGTACCACTTGGCGCGCAGTGGTCATGTCTCGACTCACGGATGGGAGCCGTTCCCGTTTGCGCTGCGGTTTGCGATCACGATCTTGGTGATCAGT
TGTCCGTGCGCCATCAGTCTCGCGGTGCCCACGGCGATTATGGTGTCGAGCACGATTGGCTCCCAGTTTGGTGTTCTCTTCAAGGGCGGCCAGGCGATCG
AGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCACGAGCGGGAATCTCGCGGTCGTCGACGTGATCATTCC
GACCACCAACGTGCCAGAAGAAAGCGCACGAAAACTGTGGAGTTACATTGCAGCGACGGAAAAGAACAGCGAACATGCGATCGGGAAAGCGCTTGTATCG
TACGCGCACCAACTCAATGCGCCGACTTTGTCGGTCGTCAAGTTTGATTCGATTCCTGGATGCGGCGTGCGTGGATTCCTGGATGATGGCCGTCAAGTCA
GTATCGGATCGCTCAAGTGGATGCAGGACGCGCTCAAGATCGGAGTGCCAGTGGATCTGCACATGGCGAACAGCAGATTCCAGCAACACGGCTACGTCGT
CGTCTCGGTCGCGATCGATAACCAGTTGGCCGCTGTGATCGCGCTTCGCGACACACCACGACCGGAGGCACGACTCGTGATTGAGCAGCTGCGACGCAAA
AAGATCCAAACGTGGATTGTCACGGGAGATCAGCGCGAGACTGCGCTCTCGGTCGCTGAGATGCTCGGTATTCCTGAATTCACTGTGATCGCCGATGCCC
TGCCGCATCAAAAGGTGGACAAGGTCCGATTGCTACAGAGCATTGGGAAGAACGTCGCGTTTGTAGGCGACGGCGTGAACGACGCCCCGGCACTCGCGAT
GGCGCACGTGGGCATCGCCGTTGGTGCTGGCACAGACGTGGCGATTGANNNNNNNNNNNNNNNNNNNNNNNNNTCTAGTGCTGGTAAAGGACGATCTGCG
CGATCTGTTGAACGGCATCGACTTGTCGCACGCCACCAACAAACTGATTCGCTGGAACTTCATGTGGGGTTTCATGTACAACGTGCTGATGATGCCGCTG
GCGTGCGGTGCGCTGTACCCGTACTTCGGCGTCTNNNNNNNNNNNNNNNNNNNNNNNNNNTCTCTCGGAGCTGCTCTCGTCGGTGCCGGTGATCCTCTTT
TCGCTGCTGCTCAACTTTTGGAAGCCTCCGTACAAGAGCCATGACGACGTGGACCCAGAGCAAGCGTTCGTCGTGGTCCAAGTGGACACGTACAGCGCCA
ACGAGAAAACGCCGCTGCTTGTGCGGAAGTAA