Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_163-snap-gene-0.23
Orientation:
(-)
Number of Exons:
3
Description :
Protein kinase
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-187
NN-scoreoddsWeighted Score
0.5375.990.012
*** None ***
TypeScore
cytoplasmic739
GO
*** None ***
*** None ***
*** None ***
Sequence
        1117 bases(100 bases per row)
ATGACGACACGCGACGCGGGGCTTACGAACGCGGCGCTGCGCGAGCTCGACATGCACCTCAGCATCCAACAGCACCACCAGACGACCAAGAGCGCCACGA
GACACATCGTCAAGCTCCACGGATACCACCTCCAAGGNNNNNNNNNNNNNNCTCATCCAAGAATACTGCGCGCGCGGAGATCTGCTTGCGGTGATGCGAC
ATGAGATCCGCATGCAGAANNNNNNNNNNNNNNNNCAGGCTTCGGCGTGCCTGTGGCCGCGCTAAACACTGTCTCTGAAGATGGGATTCGAAAGATCTTC
GCGCAGATTCTGCATGGAGTGACAGCATTGCATGACGCGGGGATCGCCCATCTCGACCTGTCGTTGGAGAATGTGTTTCTTACGGATGATGATCAAGTAC
GCGTCGGTGATTTGGGACTCGCGGAACGCTTCCACTGCACTCACAACGGTCGGATTCTGCATCAATGCCCACAGGGCATCGCGAAGGTGGCGTACGCCGC
CCCAGAGATACACGCTTCATTTGTGGCAGGTATCCCTATTGACGTCTCCAAAGCAGACTCATGGGCTCTTGGAGTCGTCTTGTGGCAGTTATGGACGAAG
CAAGCCTTGTTCCAGACCCCACCCCGTGAAGACCAACTGTTTCACCAAATGGAGCAAGTTGGGAGTGCTGAAGCGCTCAATGCGTGCCCACTATTGAGGG
ATGCTCCTAAAGAACTGAAGGACCTCTTGGGCAAGCTGCTTGATATCAATCCGCGCACCAGACTCAATGTCCGTGATGCGCTACAGCACTCATGGTTCTT
TGCAAACGCCGCTGCGCCTACTTCGCCACCGAAGCTGAAAAGAGTAACTTCTGATGCCGTGCAATATTCCCAGAAAACGATGACATCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNAGCCCACCGCAAGCAAAGGCAAAGCTCGCAGTGGGTCTTGTGGTGGAGAGATTGTTCTGGAGAGAACGCGTGTGAG
TATTCGCGGTTCTACGACGTCCCCTGCAATGAGTCCATGCGTCCGTTCATGATGAAACGAGTAAGACAAGTCGACGTGTAAGTGAGTGTGCTTATCGCAA
TGTAGTATTTGGACTGA