Transcript Name :
Pytul_var.sporangiiferumsnap_masked-pug3_contig_162-abinit-gene-0.29
Orientation:
(-)
Number of Exons:
9
Description :
Endomembrane protein 70
This protein is a Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
Y-scoreD-scoreY-pos
0.7890.85320
InsideOutsideTMhelix
1-296
*** None ***
PositionContextScore
226VHSRWRR|AT0.666
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        2245 bases(100 bases per row)
ATGCGCGCGTGGACTACGGCTGTGAGTGGCGCGCTGCTGGCGACGTCGGCGGCCGCGTTCTCGCTGCCCGGCGTGCAGATGACGACGTATGCGAAGAGCG
ACCACCTGCCGCTCTTCGTCAACAGCCTCACGTCGTCCGAGACTCTGCTGCCGCTCGATTACTACAAGCTGCCGTTCTGCCAGGTAAAGGGAGGATCTCT
GTGTGTGTTGCTAGCATGAAGAGGCTGTTGAGCGTCTAGGGGAAGTGGGCATTGATATGGGGAAGAATGCAGCGCCTCGGAAGATACTAATGTGTCCTTT
TTTTCTTTGGACGTCCGTTGTGTTCCTTGGTTGGATTTTTTTGCGTGTGCTGCAGCCAGAGAAGATCGAGTACAAGTCGGAAAACCTCGGCGAGTATTTG
ACGGCCAACCGCATTCAAAACTCTCCATATGAGGTGCGTCGTTGTGCCCCTAGATACATTTTCAAAAAAGGTTGCGATATTGGGATGATGCTCATTATGG
TTTTGACTATGGTCTAAATATCTTTATAGATCAAGTTCCTAGAGGATCAGGAGTGTACGGTGCTCTGCCAGCAGACGTACAAGGATGAAGACGTGAAGAA
ATTTGAAACGAAGGTGAAGAACTCGTACCGCGTGAACTGGTACGAAGCTTCTTTCAATGCAATGCAGCTACAGCTTGAAGGACATTTGACTAATGATGGT
GCTTGCTTTGTTATGGCAATAGGATCCTGGACAACCTTCCCGTGACGTCGGTGTCGACGGAGGGCGTCCTCGGCGTGGGGTTTCCGCTGGGCAGCTTCAA
CCCGGAAGTTGAAGTTGTGCCACAGCTCAACAATCACGTCAAGATCCGCATTGGGTACAACAACGCCATCGGCACGGCATCGCGCGAGGAAGGACGCATC
GTGGACTTCACGGTCACCCCTTACAGCTTTGCGTACAAGGAAGCGAGCTTTGTCAAAGAGAAGAACCGCATGACGTCGTGCGACCANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCCTCCACTGTACCTGAACAGCAAGGCTGGCGAACTCCCTGTGTACTGGACGTACAGCGT
CGAGTGGATCGAAGACAACGAGAAGGAGTGGCGCACGCGCTGGGACATCTATTTTGAGGCCGGGTCGGGCAGCGACCAGGTGCACTGGTTCTCGATCATC
AATGCGCTTTTGATCGTGCTGTTCCTGAGTGTGCTGGTCGGGATGATTCTCATGCGCAGTCTCCACCGTGACATTAGTCGCTACAACCGCGTGCCGACCG
ATGAAGAGCGTGCGGAAGAACGCGAAGAGTCCGGCTGGAAGCTCGTGCACGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCGTCCGC
CAACGAAGAACCCGATGCTGTTTTGCGTCATGGTCGGCACGGGCACCCAGTTGCTCGGCATGGCGCTCGTGACGCTGTTCTTTGCGGCCGTGGGTGTTCT
CGCCCCATCCAACCGCGGCAAGTTGGTAATCGCGCTGCTCGTCGTGTTTGTTTTGCTGGGCATGCTCGCGGGTTACACGTCGGCGCGCACCTACAAGATG
TTCAAGGGCAAGCGCTGGCAATTGTGCACGATCTTGACAGCGACACTGTTCCCTGGCATCCTGTTTGCGCTCTTCTTCTTCCTGAATCTGTTCGTGTGGG
GCGCCGGATCGGACGCCGCAGTGCCGTTTGGCTCGATCCTGCTCGTGTTTTTTCTCTGGACGGGCATTTCCGTGCCTTTGGTCTTTGCCGGCGCGTTCTT
CGGCTTCAGGTACGAACCACAAAATTACGACAAGCATCTTATTTCGATAGTCGGTCTTACTTACGATTGTGTTTGTTCTGTCATTCTGTAGAAAACCCGC
GAGTACATTCCCGGTGGCGACGAGCAACATTCCGCGTCCGATTCCTCCGCAGGCGTGGTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCTGC
AGTCGGAGGCGTGCTGCCCTTCGGCGCCATCTTCGTGGAGCTCTTCTTCGTGCTCTCGTCACTCTGGACCGACAAGTACTACTACGTGTTTGGTTTCCTG
CTGCTCTCGTTTGTGATTCTCGTGCACACGTGCGCCGAGATCACGATCGTGCTCACATACTTCCAGCTCTGCGCCGAAGACTACAACTGGTACGTACCTC
CTTGTCTTTGTTAGAAGTATGCGCTTTAATGAGCAGTGCGGCTGA