Transcript Name :
Albla_Nc14000560
Orientation:
(-)
Number of Exons:
10
Description :
regulator of chromosome condensation (RCC1) putative
This protein is Not Signal Peptide
This protein does Not have transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
Profile scan predictionP-Valprediction_id
EF-hand domain12.756PS50222
EF-hand domain11.389PS50222
EF-hand domain12.198PS50222
EF-hand domain11.612PS50222
Regulator of chromosome condensation, RCC115.368PS50012
HmmSmart predictionP-Valprediction_id
EF-hand domain0.0014SM00054
EF-hand domain0.001SM00054
EF-hand domain1.3SM00054
EF-hand domain0.082SM00054
*** None ***
*** None ***
*** None ***
Interpro Domain nameprediction_id
Regulator of chromosome condensation, RCC1IPR000408
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
GO
Biological ProcessGO IDPrediction Method
calcium ion bindingGO:0005509IEA
*** None ***
*** None ***
Sequence
        3558 bases(100 bases per row)
ATGAAATTGGGATTTATCGCACGATTAAAGAATCTTAAGAACAAGCAGACAAAAACACCTCTAGAGCATGATTGCCAAGCCTATGAGCCAGACCACCAGT
CTGAGATACCGAATAATACCAAGATGGACCTCTTTAGCGATGAAACCATCGCATTTCAAGCCCAGGAATCCATCGACCTGATCCCATCCGATGAGCTCTT
TGAGCTCATCGATACCGATCACTCGGGGACTATAGACAAGAAAGAGTTCGAAGCGATGGTGGGTAAGCCTTCTCCGCCCCAATTCTTCTCATGTGCTGCC
TGAATCAGCTGGCAAAGCTCGGATTCAGCGTCACAGCCACAAAGGCCGCGCGGGTCTTTCGACTTTGCGATCTCGATAACAGCGGCAAAATTGATCGAAA
TGAGTTAAAGAAAGCTATTTTCATGCTCAAGTCGGTCACTGGTGGCTCACACATCCTTCCCACGCGTCTTCCAGCGCCCAGAGACGTGTTCCAGTATTTT
GACGAAGATGGCAATGGAATGGTCGATGAGATGGAATTTGCTGTACGTATTCCACCGGCACTTGGATGCGTCTAACTGGAGCGGATAGGACATGCTCGAG
TACTTTGGATTGGAGGTGAGTGATCTGCAAAAGATGGCGCTCTTCCGAAAGTACGATCGAGACAAGAGCGGCTTCATTGAGTACCCGGAATTCCGAGATA
TTTGGCTCCGATTGTGTGACGCGCGCGAGGAGCTGCTGCAACGTGGTGTCGTAGTGAGCCCTTCCAACACCACCAAACAACTTCGACAGATGCTGGAACA
GCGTTTGGCTCAAGAAGAGCTCACAGAGGACGAAAGAGAAAAAGCTTCCAGCCTGTACTTTCATAAAGAGCAGCGTAAAGAGTTCATTTCGCTGCTTGGG
GCTCAAGCTCTTCATAGGGCGAAACAAGAGCTGGAGGCCGCTTTGGATGCTGCAGGACAAGTGTACGTCTTCGGAACGGGGAGACTCGGACGATGGGAGT
TGTCTTCGGGTACATCTCAGTACGTTTGGGGCCTTTGGGACAGTCGGATCGACCCGGAGAGCTTTCGTTCTCGAGTTCCAGAGCTCTCCGTCAAGCAGAA
AGCTTTTTCAATAAAGCAACAGCCTGCACCTCCAGCCCCCCGAGCGCCTCTAAAGAAAAAGACGGAAGCTAAACCACAACGATTTGTGCATCGACGACCA
GAAAATGTCCGTTGGACATTCCAAAGCCCACCCAAACTCGATACTCGAAGTCTCTCCGCACTCCGACGATATAGATCCAATGTGATTGCCGCTGGGAATG
AAGAATCAGAGCCCCAAGAGGTCTACGAAGCGCCCAACGACGCACCGGAGCCGCTTTTATATCGAGCCTCTAACTTCCAGCATGTCACTGTGATGAACAC
GAGCTCTCTTTGGGGTCGTCAGGTAGTGAATGGAGCCCTTGGAGATGATCATGCGCTCCTTGTTACCTCCCATGGAGACGTGCTGGAGTGGGGTCGAGAC
TCTTCACTTCAAAGCGCTTCTCCAAAGGTACGACCACGAGCCAAAGAAGCCCTCATCTGTTGTACCCCATAGCTTTTAGACCAAGAAGACCTGCTACATG
GATGTCAGGCTGTCACTTCCGTCGCTGTGAATCGAATGGAAGCCTTCGCACTCCTTCGTGACGGGTATCCTCCTTCTAAATGCTTCGTATCGGGTCATAA
GCGAGGGATTTAGATCGCTATGGGCGTGGAAATCGACGTCTCCGTCACCCTTTAGCGCTCCGAAACAGATACATAGCCTCGCGGTACGACTTTCTCAGTC
CCTTTCATCGATCTCAAGCTGTTCTATAGCATGTGTCGATCCAAAGCCTCAGCGCTTCGTCCTCTCTGAACGCTTCGATCACCACAAATGCCGAGCTGTA
CACCTGGATATCGTCTAGCGACGCTCAAGCGACCAAAATGGAGCTTCCATATGCCATTTCAAACTCTCAAAGCGTCCGATTTGTGTCGTGTGGAGCGGCT
CATTGCGGTCTCACCACACTCGATGGAAAGCTGTTCATGTGGGGCTGCGCTGACGGTGGAAGGCTGGGTCTCGGGGCGGAATTCCATGATTATATCGCAA
AGCCAACTCTGGTGGAGCCTCTCTCCAAAGAAGGCGTTCGAGTGCGGCAAGTAGCCTGCGGAACAGCTCACTCTGTCCTCTGCACAGAAAGCTATCCCGT
CGACTGGAAAAGCTGTCAGATAAACCGCTTCTTTGGAGGTAAATTGTATGCGTGTGGAAGCGTTCTACCGCTCGGAAAGCACATGCCAACGTGGGAAGCT
GTAGCCAGCAAACCCAACGATATCGCTTTCGTTCAGGTGTCTTGTGGATTCGCTCATAGCGCTGCGGTATCGGTGTCTGGGGCGCTATTTACATGGGGAA
GGAATGCCTCCGGATGCACTGGACATCCTGTATCCCGAGCTTTTATTCCCGAGCCAGAAGCCATCGACTCTATCCACAAAGAGCCTGAAAACCTCGCGAC
TGGAAAGCTTTGTAGACAGATAAGCGTGTACAACCAACAGGGAGCACATTTGGCGCTCACCGATCGTATCTCCAGCTGTATCCACACACAGATTGAAGAC
ATGCCGTGGTGGGAAATAGATATCAGTGAACCCGTCAGCATCAATCGCATTTGTGTACGAAGCGCAAGTCGATGACAAAGGCCTCTGAAAGTATTTGCAC
AGGTTTGGAGCTGCGAAGAAGGCCCCAGCACGCTGTACCCCTTCTGGGTCTTTGTCAGTCAGAAACCCTTCCAGGATACCAGAGGCGAGCGGGGGTACGT
GTGATAGCTCTCCATCTACTGCTCACTCAAGTCTGTAGCCTCCAAGCTTCAAAGGCACAAGCTATCGCCTCAAAGTACTTTTTCTCTCCTGAGAATCTGA
TGGAATGGGGGCTCCCCTGGCGATCTATCGGGCGATACATCCGGTAGAGAGCATTGGTTAGTGTCTGCTTGCTGAAGAAGAGTTTGTAGAATTCAGTCTC
AAAGGCGAGGCTTCCTTCGATTTGGTCATATTCAGGTCTTTGGAACGCATTCAGCAGCACGCGTCCTTGGGCGCGTTGCCCAGGTGCACTGTGGGTACAA
CAGGACGCTGGTGGTCCTTCCCCCGATGGCACAGAGGTGCCCTTAATGGAATGCTTATGGGATACTTTTTCTCATTATTATTCAGTTTGCTTGAGGCCTT
TTATCGTCGAGCGGTGCAAGCGGATGCGGATAATGCAACGATACTACGAGATTTCAGAGCGTACGAGGAGTTCTATGAGAGGATGGCCCGAGGACCCGAT
GGAGCTTTCGAAAATACAGAGAGATGCGAGCTTTGCGAGTTCTCGCGAGGCTGTGAGGCGTGCGCACTGTATGACGCTTTTCGTGGGGAATATCGAACGG
AATTGCCGCATAGAGGTACCAGTGATCAAAGTGGACTTCAGGTACACCTTGTCGCTGTATCGTTGTACCAGGAGGAGCTCCAAGAACTCTCTAAAGGCTT
TCATCCGTTGGGCGCTTTTGGAGCCATTGGAACACGCGCCTTTCTTAGCGGGAAATGA