Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-fgenesh-gene-0.43
Orientation:
(-)
Number of Exons:
10
Description :
Protein phosphatase 2C
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-212
NN-scoreoddsWeighted Score
0.8214.660.009
PositionContextScore
103RTIRTKR|RA0.645
TypeScore
mitochondrial783
GO
*** None ***
*** None ***
*** None ***
Sequence
        2463 bases(100 bases per row)
ATGGGTGCCTACAAGTATTTGGAAGAATTGTGGAAGCGTAAGCAGTCGGATGTGCTCCGTTTCCTGCTCCGTGTGCGTGCGTGGGAGTACCGCCAGCTGC
CAGTGATCCACCGCGTGAACGGCCCAACCCGTGTCGACAAGGCTCGTCGTCTCGGCTACAAGGCCAAGCAGGGCTACGTCGTCGCCCGTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNAAGCGCCCAAACTCGAAGGGTATTGTGTACGGTAAGCCAAAGCACCACGGTATCAACCAGCTCAAGTTCGAACG
CAACCTGCGCTCGGTGGCCGAGGAGCGTGCCGGCAACAAGTTCACCAACTTGCGCGTGCTCAACTCGTACTGGGTGAACCAGGACGCGACGTACAAGTAC
TTCGAAGTGATCCTCGTCGACTACTCGCACAAGACGATCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTCGCCAGGGCC
GTGGTCTCCGCAAGCGTGGCCACCGCGCCAACAAGATCCAGGGTTCGTCGCACCGCCAAAACTGGAAGCGCCGCAACACCTTGTCGCTCCGCCGCTACCG
TTAGANNNNNNNNNNCCGTAGTGACTCGTTCATCGTGTCGGCCTTGGTTCGCAAATGGCTTAATGCGCTCGTGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNTGCTGGTGGTCAGTTTGCTCGCTTCTCTCTGCGGCGCGTCTGTATTTCGTTTAGGTCTGTCGCGGAGCTTCGCCGTAGG
ATTTGTGTAGAGCTTTAAACGGATATAAGACGCAAGTGTAATTAAAGAGAAGCAGCGTCTTGCTTGCTGGCTGGTGTCGTGGCGCCATGGCATATTCACA
ACAATTAGTATTGAAGGCGATTCTTTCTATCTCCATTTTTGACTTGTTTTACAATTGACAAAAGAGGCTGTTGATAGTCTTCATACAAATCTCTCTGTAT
ATACATTTCGAAAAGATTCCTGTGCCTATTTTTTTTAATAGGAAACGGTGGGGAACAACCTCACATACACCTACACGAATCGAGCACGCGCGTGTGCACG
CTGTCTGTGCATAACGCTCTATTCTCTGCTCGTCTCCACAGGCTGGGAGTGTGGCGCAAGCACAACAAGATGGCAGGTTCCTTCAACTGCTGCCAGTGCG
TGAGCGTCTATGAGGAAATGGTGCGCTGTACACACTGCAGTCGCGCATTCACTGTAGCAAGCAGCACTCACTCTAATGCGCGCGTGGTGTGTGGCGGCTG
CTGTGTAGAACCCCGAGAACCGCAAGACGATGGAAGACACGGTGCGCGTCGTCGACGCACTGCTCCTGAACCCACAGAATGGGTTCTTTGCCGTGTACGA
CGGTCACGGAGGTTGGTGCATTTGAGAGCTCCATCTGCCTCATTATGGGGAGTAACAGAAAGCTGTTGCTGCCTAGGACGAGACGTTTCCGTGTATCTGC
AGCGCGCACTGCATGAGAACTTGACCACGGAGCTGCAGCTCCCAGACGACGGGAGCACGATCGAGCAGCGGATAGAGAGGTGCGCCCCATATACATCATT
GCGCGTGACTGCATTATGATTGTACAGCTTGTTCTTGAATGGAATTCTTTTCTTTGTAGGGCGTACGTGATCACGGATCTCGAGTGCTGCCAGTCGTTCT
CGGGCTCAGTGGGCTCCACGGCCGTCACGGCACTGCTGCTCGAGCAGGGCGAAGGGCGTACGCTCTTCACGTCCAACGTCGGCGACAGGTGAGATGCCGC
CTTGTCTTGGCTCAAAAGTGCGCAGAATAAGTACCTTATCGTTCGTTGACGCTGTCGATCTTCATTGATGCAGTCGTGCGGTGATCTGCCGCAATGGGAT
CGCGGTCCAGCTCACGAAAGACCACAAAGCGGACGATCCGGACGAAACGGCGCGCATCGTCAACCACGGAGGGTTCGTGGTCCAGCACCGTGTCTCGGGG
GTCCTAGCAGTGTCCAGGTTCGTGCGTCCGTACATCCCAGTATGATTACAGCATGCGAAGTCTCGTAAAGGGCTCTTCCTCTATATTCTCCTCGTGTTCT
TCATGTGATAGGAGCTTTGGTGACAGAGATCTCAAGCAGTTTGTCATTGCCAGACCCACGACGAGTGTCACCCGGTATGCTGCGTGTTCGTTTTTTTCAC
TCGACGACTGATTGATTATCTTGGGACATCATTTGCATGCTTGCTGTGCGAGTGTGTTTAACAGGCTTGAGCCAGCGCACGAGTACCCGTTTCTCGTGCT
TGCATGCGATGGCGTGTGGGACGAACTCAGCAACCAGGAAGTGGTCGATTTGGTCGCAAAGCTGCCGCCGAGTCAGCGCGAGAGCGCCGCGCGCGTCGTC
GTAGAAGAAGCGATGGCGCGTAAAAGCTGCGATAACATTTCAGCCGTTGTCGTGTTCTTCTAG