Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-snap-gene-0.82
Orientation:
(-)
Number of Exons:
2
Description :
Gene of unknown function
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-44
NN-scoreoddsWeighted Score
0.7463.550.007
*** None ***
TypeScore
nuclear522
GO
*** None ***
*** None ***
*** None ***
Sequence
        394 bases(100 bases per row)
ATGATCGATGGCCGCGACCTGCTGCTGCGCGAGAACCTCGTGGACACGGTACTCGAGGACGGCAAGACCGAGTGGCAGTGCGTCGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAACAACACGACGTTCCTGACCAACGAGACCGCGTTCCTGCACTCCGCTACGGGCGACATCCCACTG
CTGCGTAGCTCGTCGAGCGCGACCAATGCAGCCGCAGACAGCATCGAGCTCACGACGAGTGTGCGGCAGCGTGCGCTGCGGTACCGACGGCTGA