Transcript Name :
Pytul_var.sporangiiferummaker-pug3_contig_1-fgenesh-gene-0.24
Orientation:
(+)
Number of Exons:
1
Description :
DUF1279 domain-containing protein
This protein is Not Signal Peptide
This protein has transmembrane domain
Not Reviewed
Run NCBI BLAST with nr Database
Gene Model plot
Functional Annotation
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
*** None ***
InsideOutsideTMhelix
1-103
127-202
104-126
*** None ***
*** None ***
*** None ***
GO
*** None ***
*** None ***
*** None ***
Sequence
        606 bases(100 bases per row)
ATGCTGCGCAGCGCTGTCTCCCGCGGCGTGTTCGCCGCCCAGGCCACCAAGCGCGTGACGGCCACCAAGTCGTCGCTCCCAGTGATGCGCGCGACGTTCG
CGTCGGGCACCAAGTCGCCGTTCCTCAAGTCCATGCAGGTCCACGCGTTCGCGTCGGTGCCGGCCAAGGACGAGGACAAGGAAGCTGCATCGCCAGCAAA
AACGTTCGAAGAGCTGCTCAAGGAGAACGAAGAGCTGCGCAAGGAGGTCGCGGAGCTCAAGGAGAAGGTGAAGAGCAAACCGGGCAAGTTCATGGCGGTC
ATCTCGCAGTTCGGCTTGCCGTTCGTGGTGTGGTGGACGACGCTGTACATCGGCACGGGTATCGGTTTCTATGTCGCGTTCGACACCGGACTGATCGCTG
GCTCCGATGCGATTGATTTCATCATGTCGCTAGGACTCGACAAGTTCATTGACCCGCAGAGTCTGGACCCGAAGTACGGCAACATGGCGCTCGCTGTGGT
GCTGAACGAGTGCATCGAGCCGATTCGTTTCCCAATTGCATTGGCGACGATCCCAACCGTGAAGCGCATGTTTTCCAAGGACAAGCCTGCTGAGGTTAAG
CAGTAA